Incidental Mutation 'R4968:Rufy1'
ID384202
Institutional Source Beutler Lab
Gene Symbol Rufy1
Ensembl Gene ENSMUSG00000020375
Gene NameRUN and FYVE domain containing 1
SynonymsZFYVE12, 3000002E04Rik, Rabip4
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location50389286-50431125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50410607 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 333 (I333L)
Ref Sequence ENSEMBL: ENSMUSP00000020643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020643]
Predicted Effect probably benign
Transcript: ENSMUST00000020643
AA Change: I333L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020643
Gene: ENSMUSG00000020375
AA Change: I333L

DomainStartEndE-ValueType
low complexity region 15 32 N/A INTRINSIC
low complexity region 83 111 N/A INTRINSIC
RUN 211 273 1.21e-21 SMART
coiled coil region 324 384 N/A INTRINSIC
coiled coil region 409 621 N/A INTRINSIC
FYVE 638 705 1.24e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135508
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain and a FYVE-type zinc finger domain. The encoded protein binds to phosphatidylinositol-3-phosphate (PI3P) and plays a role in early endosomal trafficking, tethering and fusion through interactions with small GTPases including Rab4, Rab5 and Rab14. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Rufy1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Rufy1 APN 11 50392023 missense probably damaging 1.00
IGL01640:Rufy1 APN 11 50390378 unclassified probably benign
IGL01829:Rufy1 APN 11 50416244 nonsense probably null
IGL02559:Rufy1 APN 11 50420483 missense probably damaging 1.00
IGL03409:Rufy1 APN 11 50406483 missense probably benign 0.00
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0053:Rufy1 UTSW 11 50401465 missense probably benign 0.10
R0193:Rufy1 UTSW 11 50389852 missense probably benign 0.12
R1028:Rufy1 UTSW 11 50414598 intron probably null
R1591:Rufy1 UTSW 11 50394928 missense probably damaging 1.00
R1818:Rufy1 UTSW 11 50414572 missense probably benign 0.43
R1952:Rufy1 UTSW 11 50406406 missense probably benign 0.01
R2228:Rufy1 UTSW 11 50397784 splice site probably null
R2982:Rufy1 UTSW 11 50419708 missense possibly damaging 0.77
R4837:Rufy1 UTSW 11 50401493 missense probably damaging 0.96
R4874:Rufy1 UTSW 11 50406450 missense possibly damaging 0.80
R4959:Rufy1 UTSW 11 50401488 missense probably benign
R5204:Rufy1 UTSW 11 50406434 missense probably damaging 1.00
R5426:Rufy1 UTSW 11 50421734 missense probably damaging 1.00
R5966:Rufy1 UTSW 11 50401488 missense probably benign
R6129:Rufy1 UTSW 11 50417248 missense probably damaging 0.99
R6930:Rufy1 UTSW 11 50398380 missense probably benign 0.05
R7073:Rufy1 UTSW 11 50404463 missense probably benign 0.05
R7462:Rufy1 UTSW 11 50407828 missense possibly damaging 0.93
R7646:Rufy1 UTSW 11 50410609 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGTCAGATGCACCATCCATC -3'
(R):5'- ATTGAGAGTTCCTACCTCTGAGTTC -3'

Sequencing Primer
(F):5'- CTTGTACAATGTGTGGAACCCAG -3'
(R):5'- ACCTCTGAGTTCTGAGCAGC -3'
Posted On2016-04-27