Incidental Mutation 'R4968:Fhit'
ID384216
Institutional Source Beutler Lab
Gene Symbol Fhit
Ensembl Gene ENSMUSG00000060579
Gene Namefragile histidine triad gene
SynonymsFra14A2
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.825) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location9550092-11162035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 10421522 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 26 (V26M)
Ref Sequence ENSEMBL: ENSMUSP00000136011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160340] [ENSMUST00000160956] [ENSMUST00000161302] [ENSMUST00000161895] [ENSMUST00000162278] [ENSMUST00000162817] [ENSMUST00000179394]
Predicted Effect probably damaging
Transcript: ENSMUST00000160340
AA Change: V89M

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124017
Gene: ENSMUSG00000060579
AA Change: V89M

DomainStartEndE-ValueType
Pfam:DcpS_C 60 170 2e-9 PFAM
Pfam:HIT 72 168 6.8e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160956
AA Change: V26M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123820
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:HIT 9 57 6.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161179
Predicted Effect probably damaging
Transcript: ENSMUST00000161302
AA Change: V26M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123874
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161895
AA Change: V26M

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124957
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:DcpS_C 6 110 4.3e-10 PFAM
Pfam:HIT 9 105 2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162278
AA Change: V26M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124073
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162817
AA Change: V26M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124500
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:DcpS_C 5 100 2.3e-7 PFAM
Pfam:HIT 9 100 1.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179394
AA Change: V26M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136011
Gene: ENSMUSG00000060579
AA Change: V26M

DomainStartEndE-ValueType
Pfam:DcpS_C 7 110 8.2e-10 PFAM
Pfam:HIT 9 105 4.9e-28 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the HIT family of proteins that are characterized by the presence of a histidine triad sequence. The encoded protein is a diadenosine triphosphate hydrolase enzyme that cleaves the P(1)-P(3)-bis(5'-adenosyl) triphosphate (Ap3A) to yield AMP and ADP. This locus is very fragile and has been found to be altered in different types of cancers. Mice lacking the encoded protein display increased susceptibility to spontaneous and induced tumors. Ectopic expression of the encoded protein in such knockout mice inhibits tumor development. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit a similarly increased incidence of both spontaneous and nitrosomethylbenzalamine-induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Fhit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Fhit APN 14 9573483 missense probably benign 0.19
IGL01412:Fhit APN 14 9870065 missense probably damaging 1.00
IGL02831:Fhit APN 14 9870080 missense probably benign 0.00
IGL03025:Fhit APN 14 10421534 missense probably damaging 1.00
overtax UTSW 14 10421534 missense probably damaging 1.00
R0464:Fhit UTSW 14 10991567 start gained probably benign
R0544:Fhit UTSW 14 9870172 missense probably damaging 1.00
R3545:Fhit UTSW 14 9870095 missense probably benign 0.03
R3547:Fhit UTSW 14 9870095 missense probably benign 0.03
R3548:Fhit UTSW 14 9870095 missense probably benign 0.03
R4033:Fhit UTSW 14 10751671 intron probably benign
R4685:Fhit UTSW 14 9870091 missense probably damaging 1.00
R5624:Fhit UTSW 14 10421534 missense probably damaging 1.00
R6011:Fhit UTSW 14 9870068 missense probably benign 0.16
R6061:Fhit UTSW 14 9573435 missense probably benign 0.00
R6208:Fhit UTSW 14 9573435 missense probably benign 0.00
R6846:Fhit UTSW 14 9763762 missense possibly damaging 0.73
R7288:Fhit UTSW 14 9763784 missense probably damaging 1.00
R7625:Fhit UTSW 14 9870177 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCAACCCTCCTTAGAAGTTCTAC -3'
(R):5'- GGGATCCCATTCTATCAAAGAGTC -3'

Sequencing Primer
(F):5'- ATATTGCGGGTGCCACCAAC -3'
(R):5'- AGAGTCTTTACTAATGGAATTTGCC -3'
Posted On2016-04-27