Incidental Mutation 'R4968:Mtss1'
ID384219
Institutional Source Beutler Lab
Gene Symbol Mtss1
Ensembl Gene ENSMUSG00000022353
Gene Namemetastasis suppressor 1
SynonymsD130001D01Rik, 2310003N14Rik, MIM
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.713) question?
Stock #R4968 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location58941234-59082005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58943918 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 598 (S598P)
Ref Sequence ENSEMBL: ENSMUSP00000079239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022980] [ENSMUST00000080371]
Predicted Effect probably benign
Transcript: ENSMUST00000022980
SMART Domains Protein: ENSMUSP00000022980
Gene: ENSMUSG00000022354

DomainStartEndE-ValueType
Pfam:Complex1_LYR 13 73 1.2e-11 PFAM
Pfam:Complex1_LYR_1 14 74 5.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080371
AA Change: S598P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079239
Gene: ENSMUSG00000022353
AA Change: S598P

DomainStartEndE-ValueType
Pfam:IMD 16 241 2.1e-107 PFAM
low complexity region 257 309 N/A INTRINSIC
low complexity region 443 459 N/A INTRINSIC
low complexity region 612 628 N/A INTRINSIC
WH2 731 748 1.36e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226976
Predicted Effect probably benign
Transcript: ENSMUST00000227045
Predicted Effect probably benign
Transcript: ENSMUST00000227196
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227290
Predicted Effect probably benign
Transcript: ENSMUST00000228067
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit polycystic kidney in 50% of mice by 5 months of age. Mouse embryonic fibroblasts from mice homozygous for a different gene trap allele exhibit altered cell morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Prob1 T C 18: 35,652,552 Y883C probably damaging Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Mtss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Mtss1 APN 15 58951468 critical splice donor site probably null
IGL00693:Mtss1 APN 15 58944124 missense probably damaging 1.00
IGL00817:Mtss1 APN 15 58943632 unclassified probably null
IGL00923:Mtss1 APN 15 58943499 missense possibly damaging 0.80
IGL01704:Mtss1 APN 15 59055083 missense possibly damaging 0.91
IGL02257:Mtss1 APN 15 58956545 missense probably damaging 1.00
IGL02632:Mtss1 APN 15 58944015 missense probably damaging 0.99
IGL02829:Mtss1 APN 15 59058428 splice site probably benign
IGL02838:Mtss1 APN 15 59081515 missense probably benign 0.06
IGL02968:Mtss1 APN 15 58956515 missense possibly damaging 0.77
IGL03012:Mtss1 APN 15 59058400 missense probably damaging 0.97
IGL03022:Mtss1 APN 15 58953590 missense probably damaging 1.00
R0193:Mtss1 UTSW 15 58944017 missense probably damaging 0.99
R0498:Mtss1 UTSW 15 58945437 missense probably damaging 1.00
R0510:Mtss1 UTSW 15 58956538 missense probably benign 0.07
R0655:Mtss1 UTSW 15 59081502 missense probably damaging 0.99
R1183:Mtss1 UTSW 15 58971048 missense probably damaging 0.97
R1428:Mtss1 UTSW 15 58947390 missense probably benign 0.04
R1503:Mtss1 UTSW 15 58951672 missense probably damaging 1.00
R1597:Mtss1 UTSW 15 58943711 missense probably damaging 1.00
R1795:Mtss1 UTSW 15 59058400 missense possibly damaging 0.92
R3689:Mtss1 UTSW 15 58953536 missense probably damaging 1.00
R4724:Mtss1 UTSW 15 59081518 missense probably damaging 0.98
R4811:Mtss1 UTSW 15 58944073 missense probably damaging 1.00
R5082:Mtss1 UTSW 15 58971019 missense probably damaging 1.00
R5783:Mtss1 UTSW 15 58943524 missense probably benign 0.05
R6253:Mtss1 UTSW 15 58943719 missense probably benign 0.02
R6767:Mtss1 UTSW 15 58953581 missense probably benign 0.00
R6890:Mtss1 UTSW 15 58951659 missense probably damaging 1.00
R7001:Mtss1 UTSW 15 58948334 intron probably benign
R7502:Mtss1 UTSW 15 58948361 missense probably damaging 0.96
R7722:Mtss1 UTSW 15 59055086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATTGCTGACACCCTGGGG -3'
(R):5'- ATTATTTCTCTGTAAGTGGCGACCAG -3'

Sequencing Primer
(F):5'- GCCCCTCCCCTGCAGATG -3'
(R):5'- TAAGTGGCGACCAGGAGGC -3'
Posted On2016-04-27