Incidental Mutation 'R4968:Prob1'
ID384232
Institutional Source Beutler Lab
Gene Symbol Prob1
Ensembl Gene ENSMUSG00000073600
Gene Nameproline rich basic protein 1
SynonymsLOC381148, Gm1614
MMRRC Submission 042564-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4968 (G1)
Quality Score102
Status Not validated
Chromosome18
Chromosomal Location35650351-35655238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35652552 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 883 (Y883C)
Ref Sequence ENSEMBL: ENSMUSP00000140465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025209] [ENSMUST00000025211] [ENSMUST00000097619] [ENSMUST00000190196]
Predicted Effect probably benign
Transcript: ENSMUST00000025209
SMART Domains Protein: ENSMUSP00000025209
Gene: ENSMUSG00000024352

DomainStartEndE-ValueType
Pfam:SPATA24 10 191 1.5e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025211
SMART Domains Protein: ENSMUSP00000025211
Gene: ENSMUSG00000024353

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 48 177 5.8e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097619
AA Change: Y879C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095224
Gene: ENSMUSG00000073600
AA Change: Y879C

DomainStartEndE-ValueType
low complexity region 78 102 N/A INTRINSIC
low complexity region 142 155 N/A INTRINSIC
low complexity region 207 223 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
low complexity region 536 553 N/A INTRINSIC
low complexity region 829 848 N/A INTRINSIC
Pfam:DUF4585 862 931 4.6e-27 PFAM
low complexity region 989 1002 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186951
Predicted Effect probably damaging
Transcript: ENSMUST00000190196
AA Change: Y883C

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140465
Gene: ENSMUSG00000073600
AA Change: Y883C

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
low complexity region 146 159 N/A INTRINSIC
low complexity region 211 227 N/A INTRINSIC
low complexity region 381 400 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
low complexity region 833 852 N/A INTRINSIC
Pfam:DUF4585 864 936 7.5e-27 PFAM
low complexity region 993 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A T 11: 58,878,790 K53* probably null Het
4921513D11Rik T C 17: 79,628,222 S255P probably benign Het
Ace A G 11: 105,981,853 N367S possibly damaging Het
Agl A T 3: 116,788,526 N282K probably benign Het
Ahnak C A 19: 9,015,100 P4583T probably damaging Het
Alpi T C 1: 87,101,525 D4G probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Aplnr T C 2: 85,136,945 Y105H probably damaging Het
Arhgap9 G A 10: 127,327,006 R395K possibly damaging Het
Asah1 A G 8: 41,354,030 M119T possibly damaging Het
Atp5b T C 10: 128,083,987 F75L probably damaging Het
B4galt6 G T 18: 20,727,969 N75K possibly damaging Het
Bco1 A T 8: 117,131,094 H486L probably benign Het
Btaf1 T A 19: 36,969,951 L480Q probably null Het
Ccdc34 G T 2: 110,040,733 probably null Het
Ccdc36 C T 9: 108,412,514 V170M probably benign Het
Cdh19 T C 1: 110,925,228 S326G probably benign Het
Cep89 A G 7: 35,409,630 D178G possibly damaging Het
Cyp11b2 A T 15: 74,854,005 probably null Het
Cyp21a1 A G 17: 34,803,409 I157T possibly damaging Het
Dcbld2 A G 16: 58,424,711 D116G probably damaging Het
Ddx5 T C 11: 106,784,127 Q377R probably damaging Het
Deup1 T C 9: 15,592,428 D279G probably damaging Het
F11 G A 8: 45,245,733 A458V probably benign Het
Fhad1 C A 4: 141,918,307 G326W probably damaging Het
Fhit C T 14: 10,421,522 V26M probably damaging Het
Gjb5 A T 4: 127,356,222 V43E probably damaging Het
Grtp1 A T 8: 13,192,184 I75N probably damaging Het
Hmcn1 A G 1: 150,657,470 I3022T possibly damaging Het
Hsp90ab1 T C 17: 45,571,036 T166A probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Kcnk10 T C 12: 98,434,902 I491V probably benign Het
Kcp A T 6: 29,497,629 C519* probably null Het
Lcmt2 T C 2: 121,139,736 T69A probably benign Het
Lmf1 A G 17: 25,585,618 Y90C probably damaging Het
Lpp A G 16: 24,979,314 D612G probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1b T C 2: 40,702,707 probably null Het
Lrp1b C T 2: 41,789,062 C6Y probably damaging Het
Lrrc8c A G 5: 105,607,127 D256G probably damaging Het
Mphosph10 A G 7: 64,382,908 Y478H probably damaging Het
Mpp2 T C 11: 102,064,298 H167R probably benign Het
Mtss1 A G 15: 58,943,918 S598P probably damaging Het
Myh10 A G 11: 68,793,223 E1154G probably damaging Het
Myo10 T C 15: 25,808,184 V1218A probably damaging Het
Myo19 A G 11: 84,901,502 K599R probably damaging Het
Neurl4 T C 11: 69,907,308 M771T probably damaging Het
Nlrc4 A G 17: 74,446,941 V149A probably benign Het
Nup133 A T 8: 123,915,196 S843T probably benign Het
Olfr1386 T C 11: 49,470,531 C127R probably damaging Het
Olfr639 T C 7: 104,012,570 N44S probably damaging Het
P3h2 A G 16: 25,992,662 probably null Het
Piezo2 A T 18: 63,144,971 Y287* probably null Het
Pxdn T A 12: 30,000,012 H506Q probably benign Het
Ripor3 T C 2: 167,985,117 D658G probably benign Het
Rufy1 T A 11: 50,410,607 I333L probably benign Het
Selenok T A 14: 29,970,107 V34E probably benign Het
Selplg T C 5: 113,819,726 E173G possibly damaging Het
Sept10 A G 10: 59,181,121 F194L probably damaging Het
Sptbn2 A T 19: 4,729,202 probably null Het
St6galnac6 C T 2: 32,608,086 P6S probably benign Het
Syngr2 T C 11: 117,813,470 Y194H probably damaging Het
Thbs4 A G 13: 92,758,068 I649T possibly damaging Het
Triobp T A 15: 78,966,616 N323K probably benign Het
Ttc30b T C 2: 75,938,047 I121V probably benign Het
Tuba8 T A 6: 121,220,589 L70Q probably damaging Het
Vmn2r61 A G 7: 42,300,054 T633A probably benign Het
Zfp280b G T 10: 76,039,354 V356L probably damaging Het
Zswim4 A T 8: 84,217,372 V746D probably benign Het
Other mutations in Prob1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01400:Prob1 APN 18 35653333 missense possibly damaging 0.91
IGL02352:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02359:Prob1 APN 18 35652840 missense possibly damaging 0.53
IGL02823:Prob1 APN 18 35652747 missense possibly damaging 0.86
IGL03003:Prob1 APN 18 35653375 missense possibly damaging 0.73
IGL03390:Prob1 APN 18 35654139 missense probably benign 0.03
R0257:Prob1 UTSW 18 35653039 missense possibly damaging 0.53
R0421:Prob1 UTSW 18 35653030 missense possibly damaging 0.70
R0457:Prob1 UTSW 18 35652486 missense probably damaging 0.98
R0485:Prob1 UTSW 18 35653825 missense possibly damaging 0.53
R0575:Prob1 UTSW 18 35654721 missense possibly damaging 0.85
R1056:Prob1 UTSW 18 35653610 missense probably benign
R1147:Prob1 UTSW 18 35654806 nonsense probably null
R1334:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1727:Prob1 UTSW 18 35654311 missense possibly damaging 0.73
R1753:Prob1 UTSW 18 35653252 missense possibly damaging 0.53
R1826:Prob1 UTSW 18 35653575 missense possibly damaging 0.72
R1895:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R1937:Prob1 UTSW 18 35654226 missense possibly damaging 0.53
R2170:Prob1 UTSW 18 35654737 missense probably benign 0.18
R3435:Prob1 UTSW 18 35654241 missense possibly damaging 0.72
R4749:Prob1 UTSW 18 35652816 missense possibly damaging 0.91
R5107:Prob1 UTSW 18 35652936 missense possibly damaging 0.53
R5602:Prob1 UTSW 18 35654026 missense possibly damaging 0.96
R5646:Prob1 UTSW 18 35654114 missense probably benign 0.18
R6035:Prob1 UTSW 18 35654782 missense probably benign 0.18
R6747:Prob1 UTSW 18 35655154 missense probably damaging 0.97
R6954:Prob1 UTSW 18 35654268 missense probably benign
R7061:Prob1 UTSW 18 35654500 missense probably benign 0.18
R7292:Prob1 UTSW 18 35654550 missense possibly damaging 0.93
R7296:Prob1 UTSW 18 35653299 missense possibly damaging 0.53
R7566:Prob1 UTSW 18 35654985 missense probably benign 0.33
R7723:Prob1 UTSW 18 35652889 missense possibly damaging 0.53
R7787:Prob1 UTSW 18 35652232 missense possibly damaging 0.73
R7798:Prob1 UTSW 18 35653344 missense possibly damaging 0.93
X0067:Prob1 UTSW 18 35653091 missense possibly damaging 0.70
Z1088:Prob1 UTSW 18 35652769 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGGACCAGAGATAGGCCCATAG -3'
(R):5'- GGAATTGGAGACACCGCTTG -3'

Sequencing Primer
(F):5'- CATAGGCGGGCGGGTAG -3'
(R):5'- TCCTGCAACTGCGGTCCAG -3'
Posted On2016-04-27