Incidental Mutation 'R4969:Cep350'
ID384240
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155860279 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 2964 (I2964V)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably benign
Transcript: ENSMUST00000129865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132189
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: I2964V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: I2964V

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192007
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195048
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
primed UTSW 1 155953588 missense probably damaging 0.98
stoked UTSW 1 155915575 missense probably benign 0.03
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
R8351:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8406:Cep350 UTSW 1 155922418 missense probably benign 0.00
R8451:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8467:Cep350 UTSW 1 155915575 missense probably benign 0.03
R8543:Cep350 UTSW 1 155862376 missense probably damaging 0.98
R8714:Cep350 UTSW 1 155860731 missense probably damaging 0.98
R8810:Cep350 UTSW 1 155928116 missense probably damaging 1.00
R8837:Cep350 UTSW 1 155861772 missense probably benign 0.09
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGACTCCATGAACAACTACTCATG -3'
(R):5'- GTGCCAGCAAAGGTCTAGAC -3'

Sequencing Primer
(F):5'- CATGTATATATAGACAAGTGCCCAC -3'
(R):5'- GGTCTAGACATAGGCAGCAC -3'
Posted On2016-04-27