Incidental Mutation 'R4969:Cbfa2t2'
ID384248
Institutional Source Beutler Lab
Gene Symbol Cbfa2t2
Ensembl Gene ENSMUSG00000038533
Gene Namecore-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human)
SynonymsCbfa2t2h, MTGR1, C330013D05Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location154436481-154539356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154523980 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 370 (D370G)
Ref Sequence ENSEMBL: ENSMUSP00000105347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045270] [ENSMUST00000099178] [ENSMUST00000109725]
Predicted Effect probably damaging
Transcript: ENSMUST00000045270
AA Change: D370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043087
Gene: ENSMUSG00000038533
AA Change: D370G

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1.3e-40 PFAM
PDB:2KYG|C 420 450 3e-7 PDB
Pfam:zf-MYND 498 534 1.4e-9 PFAM
low complexity region 573 588 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099178
AA Change: D370G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096782
Gene: ENSMUSG00000038533
AA Change: D370G

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 4.4e-40 PFAM
low complexity region 402 419 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109725
AA Change: D370G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105347
Gene: ENSMUSG00000038533
AA Change: D370G

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
TAFH 106 196 1.06e-49 SMART
Pfam:NHR2 322 388 1e-40 PFAM
Pfam:zf-MYND 497 533 3.3e-11 PFAM
low complexity region 572 587 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137526
AA Change: D75G
SMART Domains Protein: ENSMUSP00000118371
Gene: ENSMUSG00000038533
AA Change: D75G

DomainStartEndE-ValueType
low complexity region 11 20 N/A INTRINSIC
Pfam:NHR2 28 94 2e-41 PFAM
Pfam:zf-MYND 203 239 3.1e-10 PFAM
low complexity region 278 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154487
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In acute myeloid leukemia, especially in the M2 subtype, the t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities. The translocation produces a chimeric gene made up of the 5'-region of the RUNX1 (AML1) gene fused to the 3'-region of the CBFA2T1 (MTG8) gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. The protein encoded by this gene binds to the AML1-MTG8 complex and may be important in promoting leukemogenesis. Several transcript variants are thought to exist for this gene, but the full-length natures of only three have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are smaller and show reduced numbers of intestinal goblet, Paneth and enteroendocrine cells, small intestine inflammation, and strain dependent postnatal lethality. Homozygotes for a different null allele are infertile due to defects in primordial germ cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Cbfa2t2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Cbfa2t2 APN 2 154528875 missense probably damaging 1.00
IGL01913:Cbfa2t2 APN 2 154517773 missense probably damaging 1.00
IGL02090:Cbfa2t2 APN 2 154531416 splice site probably benign
IGL02850:Cbfa2t2 APN 2 154535170 missense probably damaging 0.97
R0302:Cbfa2t2 UTSW 2 154534876 splice site probably benign
R0356:Cbfa2t2 UTSW 2 154531349 missense probably benign 0.03
R1218:Cbfa2t2 UTSW 2 154523919 missense probably benign 0.43
R1571:Cbfa2t2 UTSW 2 154500427 missense probably damaging 1.00
R1998:Cbfa2t2 UTSW 2 154504789 missense probably damaging 1.00
R2016:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2017:Cbfa2t2 UTSW 2 154517807 missense probably damaging 1.00
R2056:Cbfa2t2 UTSW 2 154535157 missense probably damaging 1.00
R3617:Cbfa2t2 UTSW 2 154436984 intron probably benign
R4299:Cbfa2t2 UTSW 2 154523928 missense probably damaging 1.00
R4746:Cbfa2t2 UTSW 2 154523925 missense possibly damaging 0.94
R5058:Cbfa2t2 UTSW 2 154504745 missense probably damaging 1.00
R5109:Cbfa2t2 UTSW 2 154531373 missense probably damaging 1.00
R5381:Cbfa2t2 UTSW 2 154523929 missense probably damaging 1.00
R5573:Cbfa2t2 UTSW 2 154436862 intron probably benign
R5808:Cbfa2t2 UTSW 2 154517826 splice site probably null
R5826:Cbfa2t2 UTSW 2 154500455 missense possibly damaging 0.90
R5977:Cbfa2t2 UTSW 2 154517777 missense probably damaging 1.00
R6052:Cbfa2t2 UTSW 2 154510581 missense probably damaging 1.00
R6842:Cbfa2t2 UTSW 2 154524045 missense probably benign 0.02
R6923:Cbfa2t2 UTSW 2 154534983 missense probably damaging 1.00
R7269:Cbfa2t2 UTSW 2 154515975 missense probably benign 0.37
R7318:Cbfa2t2 UTSW 2 154500454 missense probably benign 0.01
R7622:Cbfa2t2 UTSW 2 154500445 missense possibly damaging 0.90
R8030:Cbfa2t2 UTSW 2 154515896 missense probably damaging 0.96
R8691:Cbfa2t2 UTSW 2 154500483 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAAATCTGTGAGCTCTGTTTTCCC -3'
(R):5'- AGCTGGTGGGAGGAAATATTCTC -3'

Sequencing Primer
(F):5'- CTCCTTCCAATTGTTACCCATCCTTG -3'
(R):5'- GTGGGAGGAAATATTCTCTCCAC -3'
Posted On2016-04-27