Mutagenetix > Incidental Mutation

Incidental Mutation 'R4969:Susd1'

384254

Institutional Source

Beutler Lab

Gene Symbol

Susd1

Ensembl Gene

ENSMUSG00000038578

Gene Name

sushi domain containing 1

Synonyms

Gm12528

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R4969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59314683-59438633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59351679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 461 (W461R)

Ref Sequence

ENSEMBL: ENSMUSP00000103168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]

AlphaFold

E9Q3H4

Predicted Effect

probably benign
Transcript: ENSMUST00000040166
AA Change: W514R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: W514R

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	16	30	N/A	INTRINSIC
EGF	43	77	1.36e1	SMART
EGF_CA	78	129	2.92e-7	SMART
EGF_CA	130	180	2.22e-12	SMART
CCP	184	239	7.87e-9	SMART
CCP	244	299	5.48e-8	SMART
Blast:FN3	306	379	2e-6	BLAST
Blast:FN3	459	580	8e-50	BLAST
transmembrane domain	729	751	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000107544
AA Change: W461R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: W461R

Domain	Start	End	E-Value	Type
EGF	28	76	2.02e-1	SMART
EGF_CA	77	127	2.22e-12	SMART
CCP	131	186	7.87e-9	SMART
CCP	191	246	5.48e-8	SMART
Blast:FN3	253	326	2e-6	BLAST
Blast:FN3	406	527	4e-50	BLAST
transmembrane domain	676	698	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136077

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,105,519	I1525T	probably benign	Het
Agtpbp1	A	G	13: 59,500,578	V476A	probably benign	Het
Aipl1	A	G	11: 72,031,430	I151T	probably benign	Het
Apc	C	T	18: 34,312,918	R938*	probably null	Het
Atp2a2	A	G	5: 122,458,491	F855S	possibly damaging	Het
Axdnd1	T	C	1: 156,395,505	T261A	possibly damaging	Het
Cbfa2t2	A	G	2: 154,523,980	D370G	probably damaging	Het
Cep350	T	C	1: 155,860,279	I2964V	probably damaging	Het
Clec16a	T	C	16: 10,568,511	V158A	probably damaging	Het
Col6a5	G	A	9: 105,864,607	T2371I	probably damaging	Het
Cpne8	T	C	15: 90,619,726	T79A	probably damaging	Het
Cyp2b13	A	G	7: 26,080,988	R145G	probably damaging	Het
Disc1	G	A	8: 125,124,550	W391*	probably null	Het
Dnah8	G	A	17: 30,723,014	V1745I	probably damaging	Het
Dsp	T	C	13: 38,192,910	V1557A	probably benign	Het
Egfem1	T	A	3: 29,582,996	Y194N	probably damaging	Het
Eif4a3	A	G	11: 119,288,879	Y361H	probably damaging	Het
Esd	T	A	14: 74,744,713	S189R	possibly damaging	Het
Fancf	A	T	7: 51,861,448	Y269*	probably null	Het
Fbln2	A	T	6: 91,271,587	H1078L	possibly damaging	Het
Fbxw13	A	G	9: 109,181,524		probably null	Het
Fcgr2b	A	T	1: 170,963,372	V284D	probably benign	Het
Fuz	G	A	7: 44,900,294	G363R	probably damaging	Het
Gas7	A	G	11: 67,683,408	E403G	probably damaging	Het
Gnl1	A	G	17: 35,980,689	D49G	possibly damaging	Het
Gucy2g	A	G	19: 55,226,013	V561A	probably benign	Het
H1fnt	A	T	15: 98,256,335	V311E	unknown	Het
Hebp2	T	C	10: 18,544,374	T104A	probably benign	Het
Ighv1-19	T	A	12: 114,708,757	Q80L	probably benign	Het
Kctd19	T	A	8: 105,396,327		probably null	Het
Kdm3b	T	C	18: 34,822,375	L905P	probably damaging	Het
Klkb1	T	C	8: 45,282,777	D183G	probably benign	Het
Krt6b	T	C	15: 101,680,025	R67G	possibly damaging	Het
Krt75	T	C	15: 101,573,813	I7V	probably benign	Het
Lpo	A	T	11: 87,806,925	N685K	probably benign	Het
Mroh7	A	T	4: 106,680,873	I1202N	probably benign	Het
Muc4	T	A	16: 32,754,572	M1482K	probably benign	Het
Mylk	T	A	16: 34,971,440	V1494E	probably damaging	Het
Neurl4	A	G	11: 69,911,087	D17G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,709	Y228C	probably damaging	Het
Nprl2	G	A	9: 107,543,074		probably null	Het
Nxf1	A	G	19: 8,762,305		probably null	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr654	A	T	7: 104,588,523	N240Y	probably damaging	Het
Pde3b	A	G	7: 114,519,612	E662G	possibly damaging	Het
Plekhm3	G	A	1: 64,937,919	R131C	probably damaging	Het
Plpp7	T	C	2: 32,095,938	S43P	probably benign	Het
Pramel5	A	G	4: 144,271,617	L352P	probably damaging	Het
Prepl	T	C	17: 85,088,474	S27G	probably benign	Het
Ptprd	A	G	4: 76,133,305	I227T	probably damaging	Het
Pttg1ip	C	T	10: 77,584,020	Q6*	probably null	Het
Rgl1	C	T	1: 152,549,062		probably null	Het
Riiad1	C	A	3: 94,472,866	G41*	probably null	Het
Rnf214	C	T	9: 45,896,188	R239H	probably damaging	Het
Rpap3	C	T	15: 97,686,526	V346I	probably benign	Het
Scaf4	G	A	16: 90,251,943	Q328*	probably null	Het
Sec23a	A	G	12: 59,004,488		probably null	Het
Slc5a8	T	A	10: 88,904,912		probably null	Het
Slc9a8	A	G	2: 167,446,529	T183A	probably benign	Het
Sod3	A	T	5: 52,368,394	H145L	probably damaging	Het
Sp4	A	G	12: 118,299,606	V235A	probably damaging	Het
Spp1	A	C	5: 104,440,287	E185A	possibly damaging	Het
Svil	A	C	18: 5,095,516	K1124Q	probably damaging	Het
Tdrd12	A	T	7: 35,487,295		probably null	Het
Terb1	A	T	8: 104,495,163	N168K	probably benign	Het
Tnnt1	A	G	7: 4,507,574	L216P	probably damaging	Het
Ttc28	A	G	5: 111,276,255	K1463E	probably damaging	Het
Twf2	T	G	9: 106,211,899		probably null	Het
Urb1	C	T	16: 90,805,411	R90Q	probably damaging	Het
Wdr45b	A	T	11: 121,328,824	C299*	probably null	Het
Wrap73	A	G	4: 154,152,681	S54G	probably damaging	Het
Zeb2	T	C	2: 44,998,919	K323R	probably damaging	Het
Zfp410	T	C	12: 84,331,808	I302T	possibly damaging	Het

Other mutations in Susd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:Susd1	APN	4	59365817	missense	possibly damaging	0.85
IGL01705:Susd1	APN	4	59332931	splice site	probably benign
IGL01727:Susd1	APN	4	59412329	splice site	probably benign
IGL02015:Susd1	APN	4	59315745	missense	possibly damaging	0.86
IGL02102:Susd1	APN	4	59369636	missense	possibly damaging	0.70
IGL02351:Susd1	APN	4	59427985	nonsense	probably null
IGL02358:Susd1	APN	4	59427985	nonsense	probably null
IGL03210:Susd1	APN	4	59333035	critical splice acceptor site	probably null
IGL03258:Susd1	APN	4	59379655	missense	possibly damaging	0.73
R0612:Susd1	UTSW	4	59390561	splice site	probably benign
R0719:Susd1	UTSW	4	59329506	missense	possibly damaging	0.56
R0722:Susd1	UTSW	4	59379749	missense	possibly damaging	0.73
R1355:Susd1	UTSW	4	59424114	missense	possibly damaging	0.86
R1672:Susd1	UTSW	4	59411395	missense	probably damaging	0.98
R1677:Susd1	UTSW	4	59424089	missense	possibly damaging	0.85
R1921:Susd1	UTSW	4	59412191	missense	probably benign	0.03
R1933:Susd1	UTSW	4	59351695	missense	possibly damaging	0.72
R1998:Susd1	UTSW	4	59349925	missense	probably benign	0.03
R2202:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2203:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2204:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2329:Susd1	UTSW	4	59379715	missense	possibly damaging	0.85
R2510:Susd1	UTSW	4	59349855	missense	possibly damaging	0.86
R4512:Susd1	UTSW	4	59329491	missense	possibly damaging	0.96
R4732:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4733:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R5121:Susd1	UTSW	4	59379657	missense	possibly damaging	0.73
R5548:Susd1	UTSW	4	59369577	missense	probably benign	0.05
R5747:Susd1	UTSW	4	59424108	missense	probably damaging	0.98
R5776:Susd1	UTSW	4	59315363	utr 3 prime	probably benign
R5875:Susd1	UTSW	4	59412203	missense	possibly damaging	0.71
R6056:Susd1	UTSW	4	59379687	missense	possibly damaging	0.53
R6081:Susd1	UTSW	4	59411359	missense	possibly damaging	0.86
R7018:Susd1	UTSW	4	59390627	missense	probably benign	0.44
R7122:Susd1	UTSW	4	59411318	nonsense	probably null
R7161:Susd1	UTSW	4	59329581	missense	possibly damaging	0.85
R7172:Susd1	UTSW	4	59315420	splice site	probably null
R7891:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85
R8103:Susd1	UTSW	4	59365916	critical splice acceptor site	probably null
R8299:Susd1	UTSW	4	59315773	missense	probably benign	0.33
R8472:Susd1	UTSW	4	59332985	missense	possibly damaging	0.96
R8831:Susd1	UTSW	4	59379594	splice site	probably benign
R8903:Susd1	UTSW	4	59390576	missense	probably benign	0.02
R8981:Susd1	UTSW	4	59380883	missense	probably benign	0.07
R9002:Susd1	UTSW	4	59324882	missense	probably benign	0.00
R9091:Susd1	UTSW	4	59412226	missense	probably benign	0.44
R9270:Susd1	UTSW	4	59412226	missense	probably benign	0.44
R9296:Susd1	UTSW	4	59427865	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TGATACATCTCTGCCAACGG -3'
(R):5'- AAACTGCTGCCTCTGACTTC -3'

Sequencing Primer
(F):5'- GCACTGAATCTCCTGGAAATGG -3'
(R):5'- GCCTCTGACTTCTGAATCAAAATAC -3'

Posted On

2016-04-27