Incidental Mutation 'R4969:Mroh7'
ID 384256
Institutional Source Beutler Lab
Gene Symbol Mroh7
Ensembl Gene ENSMUSG00000047502
Gene Name maestro heat-like repeat family member 7
Synonyms Heatr8, Gm1027, LOC381538
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4969 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 106537614-106588122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106538070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1202 (I1202N)
Ref Sequence ENSEMBL: ENSMUSP00000102382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026480] [ENSMUST00000106770] [ENSMUST00000106772] [ENSMUST00000135676]
AlphaFold A2AVR2
Predicted Effect probably benign
Transcript: ENSMUST00000026480
SMART Domains Protein: ENSMUSP00000026480
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
low complexity region 235 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106770
AA Change: I1202N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: I1202N

DomainStartEndE-ValueType
low complexity region 39 61 N/A INTRINSIC
low complexity region 318 332 N/A INTRINSIC
low complexity region 563 573 N/A INTRINSIC
SCOP:d1b3ua_ 634 1218 6e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106772
SMART Domains Protein: ENSMUSP00000102384
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
TPR 79 112 1.26e1 SMART
TPR 117 150 7.27e0 SMART
TPR 151 184 3.07e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135000
Predicted Effect probably benign
Transcript: ENSMUST00000135676
SMART Domains Protein: ENSMUSP00000116620
Gene: ENSMUSG00000025413

DomainStartEndE-ValueType
Pfam:TPR_11 77 148 1.1e-14 PFAM
Pfam:TPR_1 79 109 8.2e-5 PFAM
Pfam:TPR_2 79 110 1.2e-3 PFAM
Blast:TPR 173 203 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145374
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 45,754,943 (GRCm39) I1525T probably benign Het
Agtpbp1 A G 13: 59,648,392 (GRCm39) V476A probably benign Het
Aipl1 A G 11: 71,922,256 (GRCm39) I151T probably benign Het
Apc C T 18: 34,445,971 (GRCm39) R938* probably null Het
Atp2a2 A G 5: 122,596,554 (GRCm39) F855S possibly damaging Het
Axdnd1 T C 1: 156,223,075 (GRCm39) T261A possibly damaging Het
Cbfa2t2 A G 2: 154,365,900 (GRCm39) D370G probably damaging Het
Cep350 T C 1: 155,736,025 (GRCm39) I2964V probably damaging Het
Clec16a T C 16: 10,386,375 (GRCm39) V158A probably damaging Het
Col6a5 G A 9: 105,741,806 (GRCm39) T2371I probably damaging Het
Cpne8 T C 15: 90,503,929 (GRCm39) T79A probably damaging Het
Cyp2b13 A G 7: 25,780,413 (GRCm39) R145G probably damaging Het
Disc1 G A 8: 125,851,289 (GRCm39) W391* probably null Het
Dnah8 G A 17: 30,941,988 (GRCm39) V1745I probably damaging Het
Dsp T C 13: 38,376,886 (GRCm39) V1557A probably benign Het
Egfem1 T A 3: 29,637,145 (GRCm39) Y194N probably damaging Het
Eif4a3 A G 11: 119,179,705 (GRCm39) Y361H probably damaging Het
Esd T A 14: 74,982,153 (GRCm39) S189R possibly damaging Het
Fancf A T 7: 51,511,196 (GRCm39) Y269* probably null Het
Fbln2 A T 6: 91,248,569 (GRCm39) H1078L possibly damaging Het
Fbxw13 A G 9: 109,010,592 (GRCm39) probably null Het
Fcgr2b A T 1: 170,790,941 (GRCm39) V284D probably benign Het
Fuz G A 7: 44,549,718 (GRCm39) G363R probably damaging Het
Gas7 A G 11: 67,574,234 (GRCm39) E403G probably damaging Het
Gnl1 A G 17: 36,291,581 (GRCm39) D49G possibly damaging Het
Gucy2g A G 19: 55,214,445 (GRCm39) V561A probably benign Het
H1f7 A T 15: 98,154,216 (GRCm39) V311E unknown Het
Hebp2 T C 10: 18,420,122 (GRCm39) T104A probably benign Het
Ighv1-19 T A 12: 114,672,377 (GRCm39) Q80L probably benign Het
Kctd19 T A 8: 106,122,959 (GRCm39) probably null Het
Kdm3b T C 18: 34,955,428 (GRCm39) L905P probably damaging Het
Klkb1 T C 8: 45,735,814 (GRCm39) D183G probably benign Het
Krt6b T C 15: 101,588,460 (GRCm39) R67G possibly damaging Het
Krt75 T C 15: 101,482,248 (GRCm39) I7V probably benign Het
Lpo A T 11: 87,697,751 (GRCm39) N685K probably benign Het
Muc4 T A 16: 32,754,572 (GRCm38) M1482K probably benign Het
Mylk T A 16: 34,791,810 (GRCm39) V1494E probably damaging Het
Neurl4 A G 11: 69,801,913 (GRCm39) D17G probably damaging Het
Nkx6-3 A G 8: 23,647,725 (GRCm39) Y228C probably damaging Het
Nprl2 G A 9: 107,420,273 (GRCm39) probably null Het
Nxf1 A G 19: 8,739,669 (GRCm39) probably null Het
Or4a39 A G 2: 89,236,770 (GRCm39) F218L probably benign Het
Or52u1 A T 7: 104,237,730 (GRCm39) N240Y probably damaging Het
Pde3b A G 7: 114,118,847 (GRCm39) E662G possibly damaging Het
Plekhm3 G A 1: 64,977,078 (GRCm39) R131C probably damaging Het
Plpp7 T C 2: 31,985,950 (GRCm39) S43P probably benign Het
Pramel5 A G 4: 143,998,187 (GRCm39) L352P probably damaging Het
Prepl T C 17: 85,395,902 (GRCm39) S27G probably benign Het
Ptprd A G 4: 76,051,542 (GRCm39) I227T probably damaging Het
Pttg1ip C T 10: 77,419,854 (GRCm39) Q6* probably null Het
Rgl1 C T 1: 152,424,813 (GRCm39) probably null Het
Riiad1 C A 3: 94,380,173 (GRCm39) G41* probably null Het
Rnf214 C T 9: 45,807,486 (GRCm39) R239H probably damaging Het
Rpap3 C T 15: 97,584,407 (GRCm39) V346I probably benign Het
Scaf4 G A 16: 90,048,831 (GRCm39) Q328* probably null Het
Sec23a A G 12: 59,051,274 (GRCm39) probably null Het
Slc5a8 T A 10: 88,740,774 (GRCm39) probably null Het
Slc9a8 A G 2: 167,288,449 (GRCm39) T183A probably benign Het
Sod3 A T 5: 52,525,736 (GRCm39) H145L probably damaging Het
Sp4 A G 12: 118,263,341 (GRCm39) V235A probably damaging Het
Spp1 A C 5: 104,588,153 (GRCm39) E185A possibly damaging Het
Susd1 A T 4: 59,351,679 (GRCm39) W461R probably benign Het
Svil A C 18: 5,095,516 (GRCm39) K1124Q probably damaging Het
Tdrd12 A T 7: 35,186,720 (GRCm39) probably null Het
Terb1 A T 8: 105,221,795 (GRCm39) N168K probably benign Het
Tnnt1 A G 7: 4,510,573 (GRCm39) L216P probably damaging Het
Ttc28 A G 5: 111,424,121 (GRCm39) K1463E probably damaging Het
Twf2 T G 9: 106,089,098 (GRCm39) probably null Het
Urb1 C T 16: 90,602,299 (GRCm39) R90Q probably damaging Het
Wdr45b A T 11: 121,219,650 (GRCm39) C299* probably null Het
Wrap73 A G 4: 154,237,138 (GRCm39) S54G probably damaging Het
Zeb2 T C 2: 44,888,931 (GRCm39) K323R probably damaging Het
Zfp410 T C 12: 84,378,582 (GRCm39) I302T possibly damaging Het
Other mutations in Mroh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Mroh7 APN 4 106,560,358 (GRCm39) missense probably benign 0.00
IGL01729:Mroh7 APN 4 106,561,402 (GRCm39) missense possibly damaging 0.66
IGL01834:Mroh7 APN 4 106,538,071 (GRCm39) missense probably benign 0.00
IGL02003:Mroh7 APN 4 106,559,726 (GRCm39) missense probably damaging 0.96
IGL02135:Mroh7 APN 4 106,559,707 (GRCm39) missense probably damaging 1.00
IGL02335:Mroh7 APN 4 106,564,979 (GRCm39) missense probably damaging 1.00
IGL02532:Mroh7 APN 4 106,577,788 (GRCm39) missense probably benign 0.04
IGL02896:Mroh7 APN 4 106,557,013 (GRCm39) missense possibly damaging 0.94
IGL03066:Mroh7 APN 4 106,549,595 (GRCm39) missense possibly damaging 0.85
IGL03298:Mroh7 APN 4 106,571,288 (GRCm39) nonsense probably null
holy UTSW 4 106,567,152 (GRCm39) splice site probably null
moley UTSW 4 106,551,509 (GRCm39) splice site probably null
P0016:Mroh7 UTSW 4 106,565,054 (GRCm39) critical splice acceptor site probably null
R0019:Mroh7 UTSW 4 106,578,623 (GRCm39) missense probably benign 0.07
R0094:Mroh7 UTSW 4 106,560,381 (GRCm39) missense probably damaging 0.98
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0105:Mroh7 UTSW 4 106,568,467 (GRCm39) missense possibly damaging 0.49
R0515:Mroh7 UTSW 4 106,548,861 (GRCm39) missense probably benign 0.01
R0828:Mroh7 UTSW 4 106,557,073 (GRCm39) missense probably damaging 0.99
R0831:Mroh7 UTSW 4 106,537,990 (GRCm39) missense possibly damaging 0.92
R1107:Mroh7 UTSW 4 106,564,791 (GRCm39) splice site probably null
R1301:Mroh7 UTSW 4 106,577,692 (GRCm39) missense probably damaging 0.99
R1456:Mroh7 UTSW 4 106,552,338 (GRCm39) splice site probably benign
R1491:Mroh7 UTSW 4 106,560,255 (GRCm39) missense probably benign 0.11
R1540:Mroh7 UTSW 4 106,560,273 (GRCm39) missense probably benign 0.11
R1560:Mroh7 UTSW 4 106,568,451 (GRCm39) missense possibly damaging 0.78
R1645:Mroh7 UTSW 4 106,577,865 (GRCm39) missense probably benign 0.19
R1804:Mroh7 UTSW 4 106,551,589 (GRCm39) missense possibly damaging 0.76
R2162:Mroh7 UTSW 4 106,557,378 (GRCm39) missense probably damaging 0.96
R2265:Mroh7 UTSW 4 106,578,124 (GRCm39) missense probably benign 0.01
R2866:Mroh7 UTSW 4 106,548,287 (GRCm39) missense probably damaging 1.00
R3716:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R3718:Mroh7 UTSW 4 106,561,407 (GRCm39) missense probably benign 0.25
R4530:Mroh7 UTSW 4 106,577,634 (GRCm39) missense possibly damaging 0.71
R4661:Mroh7 UTSW 4 106,548,710 (GRCm39) critical splice donor site probably null
R4706:Mroh7 UTSW 4 106,548,821 (GRCm39) missense possibly damaging 0.86
R4910:Mroh7 UTSW 4 106,567,152 (GRCm39) splice site probably null
R4965:Mroh7 UTSW 4 106,548,184 (GRCm39) missense possibly damaging 0.77
R4971:Mroh7 UTSW 4 106,548,749 (GRCm39) missense probably benign 0.04
R5083:Mroh7 UTSW 4 106,547,515 (GRCm39) missense probably benign 0.03
R5207:Mroh7 UTSW 4 106,578,583 (GRCm39) missense probably damaging 0.97
R5364:Mroh7 UTSW 4 106,548,840 (GRCm39) missense probably benign 0.10
R5392:Mroh7 UTSW 4 106,568,448 (GRCm39) critical splice donor site probably null
R5630:Mroh7 UTSW 4 106,577,764 (GRCm39) missense possibly damaging 0.71
R5691:Mroh7 UTSW 4 106,559,815 (GRCm39) missense probably damaging 0.96
R5703:Mroh7 UTSW 4 106,565,757 (GRCm39) missense possibly damaging 0.77
R5707:Mroh7 UTSW 4 106,539,082 (GRCm39) missense possibly damaging 0.73
R5919:Mroh7 UTSW 4 106,551,509 (GRCm39) splice site probably null
R5979:Mroh7 UTSW 4 106,578,123 (GRCm39) missense probably benign 0.00
R6479:Mroh7 UTSW 4 106,560,385 (GRCm39) missense possibly damaging 0.75
R6520:Mroh7 UTSW 4 106,578,460 (GRCm39) missense probably benign 0.00
R6657:Mroh7 UTSW 4 106,559,697 (GRCm39) nonsense probably null
R6732:Mroh7 UTSW 4 106,537,910 (GRCm39) frame shift probably null
R6817:Mroh7 UTSW 4 106,571,312 (GRCm39) missense probably benign 0.00
R6980:Mroh7 UTSW 4 106,557,434 (GRCm39) missense probably benign 0.05
R7062:Mroh7 UTSW 4 106,541,177 (GRCm39) missense probably damaging 1.00
R7116:Mroh7 UTSW 4 106,568,517 (GRCm39) missense probably benign 0.07
R7134:Mroh7 UTSW 4 106,577,791 (GRCm39) missense probably damaging 0.99
R7169:Mroh7 UTSW 4 106,548,836 (GRCm39) missense probably damaging 0.99
R7419:Mroh7 UTSW 4 106,541,115 (GRCm39) missense probably benign
R7516:Mroh7 UTSW 4 106,548,316 (GRCm39) missense probably benign 0.00
R7525:Mroh7 UTSW 4 106,566,899 (GRCm39) missense probably benign 0.22
R7540:Mroh7 UTSW 4 106,577,595 (GRCm39) missense possibly damaging 0.85
R7849:Mroh7 UTSW 4 106,578,287 (GRCm39) missense probably benign
R7920:Mroh7 UTSW 4 106,564,773 (GRCm39) missense probably benign
R7998:Mroh7 UTSW 4 106,568,478 (GRCm39) missense probably benign 0.02
R8026:Mroh7 UTSW 4 106,578,634 (GRCm39) missense probably benign 0.01
R8122:Mroh7 UTSW 4 106,559,726 (GRCm39) missense probably damaging 0.96
R8249:Mroh7 UTSW 4 106,578,409 (GRCm39) missense probably benign 0.00
R9188:Mroh7 UTSW 4 106,566,789 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCAATGCCTGCATGATCCAG -3'
(R):5'- TGCAACCGAGACAGCTGATG -3'

Sequencing Primer
(F):5'- ATGATCCAGGAGCGCCGTTG -3'
(R):5'- CTGGGGAAATCTAGGAAGGCTTC -3'
Posted On 2016-04-27