Mutagenetix > Incidental Mutations

Incidental Mutation 'R4969:Mroh7'

384256

Institutional Source

Beutler Lab

Gene Symbol

Mroh7

Ensembl Gene

ENSMUSG00000047502

Gene Name

maestro heat-like repeat family member 7

Synonyms

Heatr8, LOC381538, Gm1027

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

106680417-106730925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 106680873 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1202 (I1202N)

Ref Sequence

ENSEMBL: ENSMUSP00000102382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026480] [ENSMUST00000106770] [ENSMUST00000106772] [ENSMUST00000135676]

Predicted Effect

probably benign
Transcript: ENSMUST00000026480

SMART Domains

Protein: ENSMUSP00000026480
Gene: ENSMUSG00000025413

Domain	Start	End	E-Value	Type
TPR	79	112	1.26e1	SMART
TPR	117	150	7.27e0	SMART
TPR	151	184	3.07e1	SMART
low complexity region	235	246	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106770
AA Change: I1202N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102382
Gene: ENSMUSG00000047502
AA Change: I1202N

Domain	Start	End	E-Value	Type
low complexity region	39	61	N/A	INTRINSIC
low complexity region	318	332	N/A	INTRINSIC
low complexity region	563	573	N/A	INTRINSIC
SCOP:d1b3ua_	634	1218	6e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106772

SMART Domains

Protein: ENSMUSP00000102384
Gene: ENSMUSG00000025413

Domain	Start	End	E-Value	Type
TPR	79	112	1.26e1	SMART
TPR	117	150	7.27e0	SMART
TPR	151	184	3.07e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127571

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132572

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134160

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135000

Predicted Effect

probably benign
Transcript: ENSMUST00000135676

SMART Domains

Protein: ENSMUSP00000116620
Gene: ENSMUSG00000025413

Domain	Start	End	E-Value	Type
Pfam:TPR_11	77	148	1.1e-14	PFAM
Pfam:TPR_1	79	109	8.2e-5	PFAM
Pfam:TPR_2	79	110	1.2e-3	PFAM
Blast:TPR	173	203	1e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142342

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145374

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,105,519	I1525T	probably benign	Het
Agtpbp1	A	G	13: 59,500,578	V476A	probably benign	Het
Aipl1	A	G	11: 72,031,430	I151T	probably benign	Het
Apc	C	T	18: 34,312,918	R938*	probably null	Het
Atp2a2	A	G	5: 122,458,491	F855S	possibly damaging	Het
Axdnd1	T	C	1: 156,395,505	T261A	possibly damaging	Het
Cbfa2t2	A	G	2: 154,523,980	D370G	probably damaging	Het
Cep350	T	C	1: 155,860,279	I2964V	probably damaging	Het
Clec16a	T	C	16: 10,568,511	V158A	probably damaging	Het
Col6a5	G	A	9: 105,864,607	T2371I	probably damaging	Het
Cpne8	T	C	15: 90,619,726	T79A	probably damaging	Het
Cyp2b13	A	G	7: 26,080,988	R145G	probably damaging	Het
Disc1	G	A	8: 125,124,550	W391*	probably null	Het
Dnah8	G	A	17: 30,723,014	V1745I	probably damaging	Het
Dsp	T	C	13: 38,192,910	V1557A	probably benign	Het
Egfem1	T	A	3: 29,582,996	Y194N	probably damaging	Het
Eif4a3	A	G	11: 119,288,879	Y361H	probably damaging	Het
Esd	T	A	14: 74,744,713	S189R	possibly damaging	Het
Fancf	A	T	7: 51,861,448	Y269*	probably null	Het
Fbln2	A	T	6: 91,271,587	H1078L	possibly damaging	Het
Fbxw13	A	G	9: 109,181,524		probably null	Het
Fcgr2b	A	T	1: 170,963,372	V284D	probably benign	Het
Fuz	G	A	7: 44,900,294	G363R	probably damaging	Het
Gas7	A	G	11: 67,683,408	E403G	probably damaging	Het
Gnl1	A	G	17: 35,980,689	D49G	possibly damaging	Het
Gucy2g	A	G	19: 55,226,013	V561A	probably benign	Het
H1fnt	A	T	15: 98,256,335	V311E	unknown	Het
Hebp2	T	C	10: 18,544,374	T104A	probably benign	Het
Ighv1-19	T	A	12: 114,708,757	Q80L	probably benign	Het
Kctd19	T	A	8: 105,396,327		probably null	Het
Kdm3b	T	C	18: 34,822,375	L905P	probably damaging	Het
Klkb1	T	C	8: 45,282,777	D183G	probably benign	Het
Krt6b	T	C	15: 101,680,025	R67G	possibly damaging	Het
Krt75	T	C	15: 101,573,813	I7V	probably benign	Het
Lpo	A	T	11: 87,806,925	N685K	probably benign	Het
Muc4	T	A	16: 32,754,572	M1482K	probably benign	Het
Mylk	T	A	16: 34,971,440	V1494E	probably damaging	Het
Neurl4	A	G	11: 69,911,087	D17G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,709	Y228C	probably damaging	Het
Nprl2	G	A	9: 107,543,074		probably null	Het
Nxf1	A	G	19: 8,762,305		probably null	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr654	A	T	7: 104,588,523	N240Y	probably damaging	Het
Pde3b	A	G	7: 114,519,612	E662G	possibly damaging	Het
Plekhm3	G	A	1: 64,937,919	R131C	probably damaging	Het
Plpp7	T	C	2: 32,095,938	S43P	probably benign	Het
Pramel5	A	G	4: 144,271,617	L352P	probably damaging	Het
Prepl	T	C	17: 85,088,474	S27G	probably benign	Het
Ptprd	A	G	4: 76,133,305	I227T	probably damaging	Het
Pttg1ip	C	T	10: 77,584,020	Q6*	probably null	Het
Rgl1	C	T	1: 152,549,062		probably null	Het
Riiad1	C	A	3: 94,472,866	G41*	probably null	Het
Rnf214	C	T	9: 45,896,188	R239H	probably damaging	Het
Rpap3	C	T	15: 97,686,526	V346I	probably benign	Het
Scaf4	G	A	16: 90,251,943	Q328*	probably null	Het
Sec23a	A	G	12: 59,004,488		probably null	Het
Slc5a8	T	A	10: 88,904,912		probably null	Het
Slc9a8	A	G	2: 167,446,529	T183A	probably benign	Het
Sod3	A	T	5: 52,368,394	H145L	probably damaging	Het
Sp4	A	G	12: 118,299,606	V235A	probably damaging	Het
Spp1	A	C	5: 104,440,287	E185A	possibly damaging	Het
Susd1	A	T	4: 59,351,679	W461R	probably benign	Het
Svil	A	C	18: 5,095,516	K1124Q	probably damaging	Het
Tdrd12	A	T	7: 35,487,295		probably null	Het
Terb1	A	T	8: 104,495,163	N168K	probably benign	Het
Tnnt1	A	G	7: 4,507,574	L216P	probably damaging	Het
Ttc28	A	G	5: 111,276,255	K1463E	probably damaging	Het
Twf2	T	G	9: 106,211,899		probably null	Het
Urb1	C	T	16: 90,805,411	R90Q	probably damaging	Het
Wdr45b	A	T	11: 121,328,824	C299*	probably null	Het
Wrap73	A	G	4: 154,152,681	S54G	probably damaging	Het
Zeb2	T	C	2: 44,998,919	K323R	probably damaging	Het
Zfp410	T	C	12: 84,331,808	I302T	possibly damaging	Het

Other mutations in Mroh7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01722:Mroh7	APN	4	106703161	missense	probably benign	0.00
IGL01729:Mroh7	APN	4	106704205	missense	possibly damaging	0.66
IGL01834:Mroh7	APN	4	106680874	missense	probably benign	0.00
IGL02003:Mroh7	APN	4	106702529	missense	probably damaging	0.96
IGL02135:Mroh7	APN	4	106702510	missense	probably damaging	1.00
IGL02335:Mroh7	APN	4	106707782	missense	probably damaging	1.00
IGL02532:Mroh7	APN	4	106720591	missense	probably benign	0.04
IGL02896:Mroh7	APN	4	106699816	missense	possibly damaging	0.94
IGL03066:Mroh7	APN	4	106692398	missense	possibly damaging	0.85
IGL03298:Mroh7	APN	4	106714091	nonsense	probably null
holy	UTSW	4	106709955	splice site	probably null
moley	UTSW	4	106694312	splice site	probably null
P0016:Mroh7	UTSW	4	106707857	critical splice acceptor site	probably null
R0019:Mroh7	UTSW	4	106721426	missense	probably benign	0.07
R0094:Mroh7	UTSW	4	106703184	missense	probably damaging	0.98
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0105:Mroh7	UTSW	4	106711270	missense	possibly damaging	0.49
R0515:Mroh7	UTSW	4	106691664	missense	probably benign	0.01
R0828:Mroh7	UTSW	4	106699876	missense	probably damaging	0.99
R0831:Mroh7	UTSW	4	106680793	missense	possibly damaging	0.92
R1107:Mroh7	UTSW	4	106707594	splice site	probably null
R1301:Mroh7	UTSW	4	106720495	missense	probably damaging	0.99
R1456:Mroh7	UTSW	4	106695141	splice site	probably benign
R1491:Mroh7	UTSW	4	106703058	missense	probably benign	0.11
R1540:Mroh7	UTSW	4	106703076	missense	probably benign	0.11
R1560:Mroh7	UTSW	4	106711254	missense	possibly damaging	0.78
R1645:Mroh7	UTSW	4	106720668	missense	probably benign	0.19
R1804:Mroh7	UTSW	4	106694392	missense	possibly damaging	0.76
R2162:Mroh7	UTSW	4	106700181	missense	probably damaging	0.96
R2265:Mroh7	UTSW	4	106720927	missense	probably benign	0.01
R2866:Mroh7	UTSW	4	106691090	missense	probably damaging	1.00
R3716:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R3718:Mroh7	UTSW	4	106704210	missense	probably benign	0.25
R4530:Mroh7	UTSW	4	106720437	missense	possibly damaging	0.71
R4661:Mroh7	UTSW	4	106691513	critical splice donor site	probably null
R4706:Mroh7	UTSW	4	106691624	missense	possibly damaging	0.86
R4910:Mroh7	UTSW	4	106709955	splice site	probably null
R4965:Mroh7	UTSW	4	106690987	missense	possibly damaging	0.77
R4971:Mroh7	UTSW	4	106691552	missense	probably benign	0.04
R5083:Mroh7	UTSW	4	106690318	missense	probably benign	0.03
R5207:Mroh7	UTSW	4	106721386	missense	probably damaging	0.97
R5364:Mroh7	UTSW	4	106691643	missense	probably benign	0.10
R5392:Mroh7	UTSW	4	106711251	critical splice donor site	probably null
R5630:Mroh7	UTSW	4	106720567	missense	possibly damaging	0.71
R5691:Mroh7	UTSW	4	106702618	missense	probably damaging	0.96
R5703:Mroh7	UTSW	4	106708560	missense	possibly damaging	0.77
R5707:Mroh7	UTSW	4	106681885	missense	possibly damaging	0.73
R5919:Mroh7	UTSW	4	106694312	splice site	probably null
R5979:Mroh7	UTSW	4	106720926	missense	probably benign	0.00
R6479:Mroh7	UTSW	4	106703188	missense	possibly damaging	0.75
R6520:Mroh7	UTSW	4	106721263	missense	probably benign	0.00
R6657:Mroh7	UTSW	4	106702500	nonsense	probably null
R6732:Mroh7	UTSW	4	106680713	frame shift	probably null
R6817:Mroh7	UTSW	4	106714115	missense	probably benign	0.00
R6980:Mroh7	UTSW	4	106700237	missense	probably benign	0.05
R7062:Mroh7	UTSW	4	106683980	missense	probably damaging	1.00
R7116:Mroh7	UTSW	4	106711320	missense	probably benign	0.07
R7134:Mroh7	UTSW	4	106720594	missense	probably damaging	0.99
R7169:Mroh7	UTSW	4	106691639	missense	probably damaging	0.99
R7419:Mroh7	UTSW	4	106683918	missense	probably benign
R7516:Mroh7	UTSW	4	106691119	missense	probably benign	0.00
R7525:Mroh7	UTSW	4	106709702	missense	probably benign	0.22
R7540:Mroh7	UTSW	4	106720398	missense	possibly damaging	0.85
R7849:Mroh7	UTSW	4	106721090	missense	probably benign
R7920:Mroh7	UTSW	4	106707576	missense	probably benign
R7998:Mroh7	UTSW	4	106711281	missense	probably benign	0.02
R8026:Mroh7	UTSW	4	106721437	missense	probably benign	0.01
R8122:Mroh7	UTSW	4	106702529	missense	probably damaging	0.96
R8249:Mroh7	UTSW	4	106721212	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCAATGCCTGCATGATCCAG -3'
(R):5'- TGCAACCGAGACAGCTGATG -3'

Sequencing Primer
(F):5'- ATGATCCAGGAGCGCCGTTG -3'
(R):5'- CTGGGGAAATCTAGGAAGGCTTC -3'

Posted On

2016-04-27