Incidental Mutation 'R4969:Atp2a2'
ID384263
Institutional Source Beutler Lab
Gene Symbol Atp2a2
Ensembl Gene ENSMUSG00000029467
Gene NameATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Synonyms9530097L16Rik, SERCA2, D5Wsu150e, SERCA2B, sarco/endoplasmic reticulum Ca2+-ATPase 2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location122453513-122502225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122458491 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 855 (F855S)
Ref Sequence ENSEMBL: ENSMUSP00000135935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031423] [ENSMUST00000177974] [ENSMUST00000179939]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031423
AA Change: F855S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031423
Gene: ENSMUSG00000029467
AA Change: F855S

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 2.1e-66 PFAM
Pfam:Hydrolase 345 714 1.2e-18 PFAM
Pfam:HAD 348 711 1e-18 PFAM
Pfam:Cation_ATPase 418 527 2.5e-24 PFAM
Pfam:Hydrolase_3 682 746 1.9e-7 PFAM
Pfam:Cation_ATPase_C 783 986 2.4e-48 PFAM
transmembrane domain 1015 1032 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000177974
AA Change: F855S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136104
Gene: ENSMUSG00000029467
AA Change: F855S

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 92 340 5.1e-66 PFAM
Pfam:Hydrolase 345 714 2.7e-18 PFAM
Pfam:HAD 348 711 2.6e-18 PFAM
Pfam:Cation_ATPase 418 527 4.7e-24 PFAM
Pfam:Hydrolase_3 682 746 7.2e-7 PFAM
Pfam:Cation_ATPase_C 783 986 5.9e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000179939
AA Change: F855S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135935
Gene: ENSMUSG00000029467
AA Change: F855S

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 9e-13 SMART
Pfam:E1-E2_ATPase 93 341 9e-69 PFAM
Pfam:HAD 348 711 1.2e-16 PFAM
Pfam:Hydrolase_like2 418 527 3.1e-24 PFAM
Pfam:Hydrolase 496 714 8.7e-24 PFAM
Pfam:Hydrolase_3 682 746 3.4e-7 PFAM
Pfam:Cation_ATPase_C 783 986 1.6e-47 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
PHENOTYPE: Targeted homozygous mutants are embryonic lethal while heterozygotes show reduced blood pressure and mildly impaired cardiac contractility and relaxation. Aged heterozygotes for one targeted mutation develop squamous cell tumors of the forestomach, esophagus, oral mucosa, tongue, and skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Atp2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Atp2a2 APN 5 122458083 splice site probably null
IGL01459:Atp2a2 APN 5 122469652 missense probably benign 0.03
IGL01721:Atp2a2 APN 5 122500792 missense possibly damaging 0.89
IGL02614:Atp2a2 APN 5 122489303 missense probably benign 0.00
IGL02616:Atp2a2 APN 5 122461684 missense probably benign 0.07
IGL02826:Atp2a2 APN 5 122489291 missense probably benign 0.03
IGL02876:Atp2a2 APN 5 122466008 missense probably benign 0.18
PIT4458001:Atp2a2 UTSW 5 122457309 nonsense probably null
R0087:Atp2a2 UTSW 5 122460961 missense probably benign 0.02
R0139:Atp2a2 UTSW 5 122491715 missense probably damaging 1.00
R0166:Atp2a2 UTSW 5 122466838 missense possibly damaging 0.69
R0457:Atp2a2 UTSW 5 122469714 missense probably benign
R0658:Atp2a2 UTSW 5 122457633 splice site probably benign
R0815:Atp2a2 UTSW 5 122471236 missense probably benign 0.02
R1282:Atp2a2 UTSW 5 122491754 missense probably benign 0.00
R1538:Atp2a2 UTSW 5 122457377 missense probably damaging 1.00
R1985:Atp2a2 UTSW 5 122466836 missense probably benign 0.03
R2111:Atp2a2 UTSW 5 122459546 missense probably damaging 1.00
R2517:Atp2a2 UTSW 5 122457513 missense probably damaging 0.99
R4225:Atp2a2 UTSW 5 122469726 missense probably benign
R4473:Atp2a2 UTSW 5 122457264 missense probably benign 0.01
R4956:Atp2a2 UTSW 5 122461580 missense probably benign 0.02
R5242:Atp2a2 UTSW 5 122461946 missense probably damaging 1.00
R5307:Atp2a2 UTSW 5 122461747 missense probably benign 0.06
R5497:Atp2a2 UTSW 5 122458169 missense probably damaging 1.00
R5536:Atp2a2 UTSW 5 122457182 missense probably benign 0.05
R5629:Atp2a2 UTSW 5 122460096 missense probably damaging 1.00
R5641:Atp2a2 UTSW 5 122457576 missense probably damaging 1.00
R6365:Atp2a2 UTSW 5 122461916 missense probably benign 0.20
R6383:Atp2a2 UTSW 5 122501649 missense probably benign 0.37
R6534:Atp2a2 UTSW 5 122457198 missense possibly damaging 0.73
R7162:Atp2a2 UTSW 5 122489324 missense probably benign 0.00
R7259:Atp2a2 UTSW 5 122466069 missense probably benign 0.27
R7268:Atp2a2 UTSW 5 122467729 missense probably benign 0.00
R7465:Atp2a2 UTSW 5 122461700 missense probably benign
R7489:Atp2a2 UTSW 5 122467767 missense probably benign
R7567:Atp2a2 UTSW 5 122491784 missense probably benign 0.29
R7729:Atp2a2 UTSW 5 122491766 missense probably benign 0.30
R7734:Atp2a2 UTSW 5 122458527 missense possibly damaging 0.95
R7739:Atp2a2 UTSW 5 122469705 missense probably damaging 0.98
R7743:Atp2a2 UTSW 5 122461571 missense probably benign 0.32
R7934:Atp2a2 UTSW 5 122461576 missense probably benign 0.00
R8822:Atp2a2 UTSW 5 122491709 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- ACTGAGTTCAAGGCCCAAC -3'
(R):5'- TAGCTCTGTGGCACCTAGTG -3'

Sequencing Primer
(F):5'- ATACGGAATACAGCTCGGC -3'
(R):5'- CCTAGTGCAGGGCGTGG -3'
Posted On2016-04-27