Incidental Mutation 'R4969:Tnnt1'
ID384265
Institutional Source Beutler Lab
Gene Symbol Tnnt1
Ensembl Gene ENSMUSG00000064179
Gene Nametroponin T1, skeletal, slow
SynonymsssTnT, sTnT, Tnt, skeletal muscle slow-twitch TnT
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location4504570-4516382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4507574 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 216 (L216P)
Ref Sequence ENSEMBL: ENSMUSP00000137198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071798] [ENSMUST00000108587] [ENSMUST00000163538] [ENSMUST00000163710] [ENSMUST00000163722] [ENSMUST00000166161] [ENSMUST00000166268] [ENSMUST00000166959] [ENSMUST00000178163]
Predicted Effect probably damaging
Transcript: ENSMUST00000071798
AA Change: L216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071704
Gene: ENSMUSG00000064179
AA Change: L216P

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000086502
Predicted Effect probably damaging
Transcript: ENSMUST00000108587
AA Change: L217P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104228
Gene: ENSMUSG00000064179
AA Change: L217P

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 205 3e-36 PFAM
Pfam:Troponin 197 260 4.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163538
SMART Domains Protein: ENSMUSP00000127964
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Pfam:Troponin 68 160 4.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163710
AA Change: L205P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129626
Gene: ENSMUSG00000064179
AA Change: L205P

DomainStartEndE-ValueType
coiled coil region 2 29 N/A INTRINSIC
Pfam:Troponin 57 199 1.9e-39 PFAM
low complexity region 235 248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163722
SMART Domains Protein: ENSMUSP00000129409
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 17 64 N/A INTRINSIC
Pfam:Troponin 76 118 1.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000166161
AA Change: L204P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125795
Gene: ENSMUSG00000064179
AA Change: L204P

DomainStartEndE-ValueType
low complexity region 5 46 N/A INTRINSIC
Pfam:Troponin 56 198 3.4e-40 PFAM
low complexity region 234 247 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166268
AA Change: L206P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128476
Gene: ENSMUSG00000064179
AA Change: L206P

DomainStartEndE-ValueType
coiled coil region 2 28 N/A INTRINSIC
Pfam:Troponin 58 200 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166959
SMART Domains Protein: ENSMUSP00000129109
Gene: ENSMUSG00000064179

DomainStartEndE-ValueType
low complexity region 5 57 N/A INTRINSIC
Pfam:Troponin 69 192 1.5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169571
Predicted Effect probably damaging
Transcript: ENSMUST00000178163
AA Change: L216P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137198
Gene: ENSMUSG00000064179
AA Change: L216P

DomainStartEndE-ValueType
low complexity region 5 40 N/A INTRINSIC
low complexity region 44 55 N/A INTRINSIC
Pfam:Troponin 68 210 7.3e-40 PFAM
low complexity region 246 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the slow skeletal tropomyosin-binding subunit of the troponin complex and plays an essential role in the regulation of striated muscle contraction. In humans, mutations in this gene are associated with nemaline myopathy type 5. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a null or hypomorphic allele show small and loss of type I slow skeletal muscle fibers with compensatory hypertrophy of type II fast fibers and reduced contractile force and tolerance of skeletal muscle fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Tnnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Tnnt1 APN 7 4507550 missense possibly damaging 0.96
IGL01391:Tnnt1 APN 7 4514212 critical splice donor site probably null
IGL01582:Tnnt1 APN 7 4509983 missense probably damaging 1.00
R0098:Tnnt1 UTSW 7 4509045 missense probably damaging 0.99
R0963:Tnnt1 UTSW 7 4507595 missense probably damaging 1.00
R1489:Tnnt1 UTSW 7 4507525 nonsense probably null
R2340:Tnnt1 UTSW 7 4513616 splice site probably benign
R4224:Tnnt1 UTSW 7 4510007 missense probably damaging 1.00
R4624:Tnnt1 UTSW 7 4512268 intron probably benign
R5245:Tnnt1 UTSW 7 4510067 missense probably damaging 1.00
R5822:Tnnt1 UTSW 7 4516346 nonsense probably null
R6520:Tnnt1 UTSW 7 4509061 nonsense probably null
R6556:Tnnt1 UTSW 7 4509577 missense probably damaging 1.00
R6573:Tnnt1 UTSW 7 4514334 splice site probably null
R6838:Tnnt1 UTSW 7 4507407 missense possibly damaging 0.94
R7318:Tnnt1 UTSW 7 4510548 splice site probably null
R7889:Tnnt1 UTSW 7 4508583 missense probably damaging 1.00
R8405:Tnnt1 UTSW 7 4507593 missense probably damaging 0.98
X0010:Tnnt1 UTSW 7 4509971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAATTTCTGGGCGTGGCTG -3'
(R):5'- TTCTGTTTCAGAAAGTGGTCACAC -3'

Sequencing Primer
(F):5'- CTGATGCGGTTGTAGAGCAC -3'
(R):5'- CACACATTTGAAAACCTTTTGTGGGC -3'
Posted On2016-04-27