Incidental Mutation 'R4969:Fuz'
ID384268
Institutional Source Beutler Lab
Gene Symbol Fuz
Ensembl Gene ENSMUSG00000011658
Gene Namefuzzy planar cell polarity protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location44896079-44902631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 44900294 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 363 (G363R)
Ref Sequence ENSEMBL: ENSMUSP00000147169 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071207] [ENSMUST00000085399] [ENSMUST00000107857] [ENSMUST00000166972] [ENSMUST00000167930] [ENSMUST00000207069] [ENSMUST00000207154] [ENSMUST00000209039] [ENSMUST00000207485] [ENSMUST00000209132] [ENSMUST00000209163] [ENSMUST00000208600] [ENSMUST00000208179] [ENSMUST00000207939]
Predicted Effect probably damaging
Transcript: ENSMUST00000071207
AA Change: G399R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071194
Gene: ENSMUSG00000011658
AA Change: G399R

DomainStartEndE-ValueType
low complexity region 234 259 N/A INTRINSIC
low complexity region 292 310 N/A INTRINSIC
low complexity region 382 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085399
SMART Domains Protein: ENSMUSP00000082519
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7.5e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 9.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107857
SMART Domains Protein: ENSMUSP00000103489
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164374
AA Change: R796Q
Predicted Effect possibly damaging
Transcript: ENSMUST00000166552
AA Change: G363R

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000126187
Gene: ENSMUSG00000011658
AA Change: G363R

DomainStartEndE-ValueType
low complexity region 198 223 N/A INTRINSIC
low complexity region 256 274 N/A INTRINSIC
low complexity region 346 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166972
SMART Domains Protein: ENSMUSP00000127842
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 2e-149 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 699 741 N/A INTRINSIC
Alpha_adaptinC2 745 858 4.49e-23 SMART
Pfam:Alpha_adaptin_C 864 972 5.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167930
SMART Domains Protein: ENSMUSP00000127497
Gene: ENSMUSG00000060279

DomainStartEndE-ValueType
Pfam:Adaptin_N 29 591 7e-150 PFAM
low complexity region 646 657 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
Alpha_adaptinC2 723 836 4.49e-23 SMART
Pfam:Alpha_adaptin_C 842 950 9.1e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168389
AA Change: G333R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128583
Gene: ENSMUSG00000011658
AA Change: G333R

DomainStartEndE-ValueType
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 244 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171169
AA Change: G639R
Predicted Effect probably benign
Transcript: ENSMUST00000207069
Predicted Effect probably benign
Transcript: ENSMUST00000207154
Predicted Effect probably benign
Transcript: ENSMUST00000209039
AA Change: G333R

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably damaging
Transcript: ENSMUST00000207485
AA Change: G363R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208472
Predicted Effect probably benign
Transcript: ENSMUST00000208908
Predicted Effect probably benign
Transcript: ENSMUST00000209132
Predicted Effect probably benign
Transcript: ENSMUST00000209163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208291
Predicted Effect probably benign
Transcript: ENSMUST00000208600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209067
Predicted Effect probably benign
Transcript: ENSMUST00000208179
Predicted Effect probably benign
Transcript: ENSMUST00000207939
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a planar cell polarity protein that is involved in ciliogenesis and directional cell movement. Knockout studies in mice exhibit neural tube defects and defective cilia, and mutations in this gene are associated with neural tube defects in humans. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit neural tube closure defects, abnormal craniofacial morphology, abnormal skeletal morphology, polydactyly, anopthalmia, pulmonary hopyplasia, and cardiac outflow tract defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Fuz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Fuz APN 7 44896959 missense probably damaging 1.00
R0211:Fuz UTSW 7 44899022 splice site probably null
R0586:Fuz UTSW 7 44898558 missense possibly damaging 0.59
R1028:Fuz UTSW 7 44896926 missense probably damaging 1.00
R1720:Fuz UTSW 7 44896991 missense probably damaging 1.00
R5278:Fuz UTSW 7 44896277 missense probably benign 0.11
R5870:Fuz UTSW 7 44900318 missense probably damaging 1.00
R6972:Fuz UTSW 7 44897331 critical splice donor site probably benign
R7440:Fuz UTSW 7 44896572 missense probably damaging 1.00
R8034:Fuz UTSW 7 44896260 start codon destroyed probably null
R8486:Fuz UTSW 7 44898668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCCTTCCTCAGAACCAGG -3'
(R):5'- CTGCTGCTGTTTACATTCTAGG -3'

Sequencing Primer
(F):5'- TTCCTCAGAACCAGGGCCTG -3'
(R):5'- AGGAAGTAGGTACCTCTCCCC -3'
Posted On2016-04-27