Incidental Mutation 'R0347:Nfatc2'
ID38427
Institutional Source Beutler Lab
Gene Symbol Nfatc2
Ensembl Gene ENSMUSG00000027544
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2
SynonymsNFAT1-D, NFATp, NFAT1
MMRRC Submission 038554-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0347 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location168476410-168601657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 168536290 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 465 (T465K)
Ref Sequence ENSEMBL: ENSMUSP00000118329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029057] [ENSMUST00000074618] [ENSMUST00000109184] [ENSMUST00000137451] [ENSMUST00000171689]
Predicted Effect probably damaging
Transcript: ENSMUST00000029057
AA Change: T485K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029057
Gene: ENSMUSG00000027544
AA Change: T485K

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 2.6e-24 PFAM
Blast:IPT 579 618 8e-19 BLAST
SCOP:d1imhc1 579 619 3e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000074618
AA Change: T485K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074198
Gene: ENSMUSG00000027544
AA Change: T485K

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD_DNA_bind 412 572 2.8e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099067
Predicted Effect probably damaging
Transcript: ENSMUST00000109184
AA Change: T485K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104812
Gene: ENSMUSG00000027544
AA Change: T485K

DomainStartEndE-ValueType
low complexity region 4 22 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
low complexity region 170 187 N/A INTRINSIC
low complexity region 236 255 N/A INTRINSIC
low complexity region 267 283 N/A INTRINSIC
Pfam:RHD 412 572 1.3e-24 PFAM
IPT 579 678 1.65e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137451
AA Change: T465K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118329
Gene: ENSMUSG00000027544
AA Change: T465K

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
low complexity region 150 167 N/A INTRINSIC
low complexity region 216 235 N/A INTRINSIC
low complexity region 247 263 N/A INTRINSIC
Pfam:RHD 392 552 7.9e-25 PFAM
Blast:IPT 559 598 8e-19 BLAST
SCOP:d1imhc1 559 599 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151292
Predicted Effect probably damaging
Transcript: ENSMUST00000171689
AA Change: T264K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130875
Gene: ENSMUSG00000027544
AA Change: T264K

DomainStartEndE-ValueType
low complexity region 15 34 N/A INTRINSIC
low complexity region 46 62 N/A INTRINSIC
Pfam:RHD 191 351 1.3e-24 PFAM
Blast:IPT 358 397 4e-19 BLAST
SCOP:d1imhc1 358 398 1e-9 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nuclear factor of activated T cells (NFAT) family. The product of this gene is a DNA-binding protein with a REL-homology region (RHR) and an NFAT-homology region (NHR). This protein is present in the cytosol and only translocates to the nucleus upon T cell receptor (TCR) stimulation, where it becomes a member of the nuclear factors of activated T cells transcription complex. This complex plays a central role in inducing gene transcription during the immune response. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mutations in this locus cause altered immune system function such as decreased cytokine production by mast cells, increased Th2 responses after infection with a parasite but decreased Th1 responses after myobacterial infection, retarded thymic involutionand massive germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
5830411N06Rik T A 7: 140,297,854 H800Q probably damaging Het
Abca4 A G 3: 122,120,099 E908G probably benign Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nipbl A G 15: 8,350,732 S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tecrl T C 5: 83,294,632 E198G probably damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Zfp959 T A 17: 55,897,180 Y69* probably null Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in Nfatc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Nfatc2 APN 2 168504890 missense probably damaging 1.00
IGL01728:Nfatc2 APN 2 168536242 missense probably damaging 1.00
IGL02303:Nfatc2 APN 2 168506901 nonsense probably null
IGL02887:Nfatc2 APN 2 168504450 missense probably damaging 1.00
IGL03002:Nfatc2 APN 2 168534984 missense probably damaging 1.00
IGL03297:Nfatc2 APN 2 168536218 missense probably damaging 0.99
R0590:Nfatc2 UTSW 2 168571199 missense probably damaging 0.99
R0631:Nfatc2 UTSW 2 168590115 missense probably benign 0.02
R1019:Nfatc2 UTSW 2 168504879 missense probably damaging 1.00
R1183:Nfatc2 UTSW 2 168590088 missense possibly damaging 0.83
R1420:Nfatc2 UTSW 2 168504665 missense probably benign 0.01
R1977:Nfatc2 UTSW 2 168504459 missense possibly damaging 0.68
R2306:Nfatc2 UTSW 2 168590103 missense probably damaging 1.00
R3034:Nfatc2 UTSW 2 168535020 missense probably damaging 1.00
R3176:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3276:Nfatc2 UTSW 2 168506994 missense possibly damaging 0.51
R3964:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R3966:Nfatc2 UTSW 2 168504549 missense probably benign 0.00
R4669:Nfatc2 UTSW 2 168571490 missense probably benign
R4864:Nfatc2 UTSW 2 168536392 missense probably damaging 0.96
R4951:Nfatc2 UTSW 2 168571072 missense probably damaging 0.98
R5138:Nfatc2 UTSW 2 168536309 missense probably damaging 1.00
R5145:Nfatc2 UTSW 2 168590067 missense probably benign 0.25
R5185:Nfatc2 UTSW 2 168570707 missense possibly damaging 0.48
R5444:Nfatc2 UTSW 2 168534890 intron probably benign
R5496:Nfatc2 UTSW 2 168536278 missense probably damaging 1.00
R5728:Nfatc2 UTSW 2 168480249 missense probably benign
R5791:Nfatc2 UTSW 2 168536393 missense probably benign 0.28
R6102:Nfatc2 UTSW 2 168519507 intron probably benign
R6157:Nfatc2 UTSW 2 168519451 intron probably benign
R6187:Nfatc2 UTSW 2 168480238 missense probably benign 0.13
R7116:Nfatc2 UTSW 2 168507349 missense probably benign 0.04
R7218:Nfatc2 UTSW 2 168571264 missense probably benign 0.01
R7470:Nfatc2 UTSW 2 168523307 nonsense probably null
R7594:Nfatc2 UTSW 2 168523348 missense probably damaging 1.00
R7618:Nfatc2 UTSW 2 168534999 missense probably damaging 1.00
R7653:Nfatc2 UTSW 2 168571145 missense probably benign 0.01
Z1176:Nfatc2 UTSW 2 168571349 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACACTGTCACTCAGGCTCTGCTC -3'
(R):5'- AGCATCCGTTTTAGAGGAGGTCCC -3'

Sequencing Primer
(F):5'- TCGCTCTCCCGAGAAGTC -3'
(R):5'- TGTTCAGCCAGTGGTCAGAC -3'
Posted On2013-05-23