Incidental Mutation 'R4969:Sp4'
ID384296
Institutional Source Beutler Lab
Gene Symbol Sp4
Ensembl Gene ENSMUSG00000025323
Gene Nametrans-acting transcription factor 4
Synonyms5730497N03Rik, HF1-b, HF-1b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118234933-118301440 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 118299606 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 235 (V235A)
Ref Sequence ENSEMBL: ENSMUSP00000152603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026367] [ENSMUST00000221844] [ENSMUST00000222314]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026367
AA Change: V235A

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026367
Gene: ENSMUSG00000025323
AA Change: V235A

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 146 N/A INTRINSIC
internal_repeat_1 157 255 4.15e-6 PROSPERO
internal_repeat_2 203 265 5.92e-5 PROSPERO
low complexity region 272 296 N/A INTRINSIC
low complexity region 300 342 N/A INTRINSIC
low complexity region 364 378 N/A INTRINSIC
low complexity region 392 421 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
internal_repeat_2 451 506 5.92e-5 PROSPERO
internal_repeat_1 461 539 4.15e-6 PROSPERO
low complexity region 540 549 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 595 607 N/A INTRINSIC
low complexity region 629 638 N/A INTRINSIC
ZnF_C2H2 645 669 2.82e0 SMART
ZnF_C2H2 675 699 7.37e-4 SMART
ZnF_C2H2 705 727 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000221844
Predicted Effect probably damaging
Transcript: ENSMUST00000222314
AA Change: V235A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that can bind to the GC promoter region of a variety of genes, including those of the photoreceptor signal transduction system. The encoded protein binds to the same sites in promoter CpG islands as does the transcription factor SP1, although its expression is much more restricted compared to that of SP1. This gene may be involved in bipolar disorder and schizophrenia. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac arrhythmias and most die shortly after birth. Surviving males complete spermatogenesis but do not copulate, while females show delayed sexual maturation and reduction in spleen, thymus, and uterus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Sp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02103:Sp4 APN 12 118299549 missense probably damaging 0.99
IGL02817:Sp4 APN 12 118299552 missense probably damaging 1.00
IGL02833:Sp4 APN 12 118261881 missense probably benign 0.05
Deadloss UTSW 12 118254439 missense possibly damaging 0.82
Speck UTSW 12 118300811 splice site probably null
R0128:Sp4 UTSW 12 118300816 splice site probably benign
R0130:Sp4 UTSW 12 118300816 splice site probably benign
R0398:Sp4 UTSW 12 118298673 missense possibly damaging 0.79
R0626:Sp4 UTSW 12 118299579 missense probably damaging 1.00
R1193:Sp4 UTSW 12 118299246 missense possibly damaging 0.94
R1775:Sp4 UTSW 12 118299600 missense probably damaging 0.99
R4724:Sp4 UTSW 12 118261809 missense probably benign
R4861:Sp4 UTSW 12 118300811 splice site probably null
R4861:Sp4 UTSW 12 118300811 splice site probably null
R5049:Sp4 UTSW 12 118254472 missense probably benign 0.04
R5178:Sp4 UTSW 12 118261889 missense possibly damaging 0.46
R5208:Sp4 UTSW 12 118299546 missense probably damaging 1.00
R5722:Sp4 UTSW 12 118299241 missense possibly damaging 0.66
R6318:Sp4 UTSW 12 118238178 missense probably damaging 1.00
R6619:Sp4 UTSW 12 118299342 missense possibly damaging 0.92
R6917:Sp4 UTSW 12 118299173 missense probably damaging 1.00
R7195:Sp4 UTSW 12 118300072 missense possibly damaging 0.92
R7614:Sp4 UTSW 12 118254439 missense possibly damaging 0.82
R7747:Sp4 UTSW 12 118254404 splice site probably null
R7983:Sp4 UTSW 12 118301232 start codon destroyed probably null
R8709:Sp4 UTSW 12 118299454 missense possibly damaging 0.66
R8817:Sp4 UTSW 12 118261889 missense possibly damaging 0.92
Z1177:Sp4 UTSW 12 118300059 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CGTAGAAACTAACTGATTCCCATTGG -3'
(R):5'- AACTTCAGACGGTGGAAGGC -3'

Sequencing Primer
(F):5'- ATTGGAAGTCCCACTGTCAG -3'
(R):5'- TGGAAGGCCAGCAAATTCAAATC -3'
Posted On2016-04-27