Incidental Mutation 'R0347:Abca4'
ID38430
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission 038554-MU
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0347 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122120099 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 908 (E908G)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995]
Predicted Effect probably benign
Transcript: ENSMUST00000013995
AA Change: E908G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: E908G

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140913
Meta Mutation Damage Score 0.0835 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
5830411N06Rik T A 7: 140,297,854 H800Q probably damaging Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nfatc2 G T 2: 168,536,290 T465K probably damaging Het
Nipbl A G 15: 8,350,732 S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tecrl T C 5: 83,294,632 E198G probably damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Zfp959 T A 17: 55,897,180 Y69* probably null Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 intron probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 intron probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7072:Abca4 UTSW 3 122173943 missense probably damaging 1.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7944:Abca4 UTSW 3 122069248 intron probably null
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AAATGCATCTGTCCCCACTGCC -3'
(R):5'- GTCAGCACATTTGTGCGATTCCC -3'

Sequencing Primer
(F):5'- ACTGCCCCTCCTCTTCTC -3'
(R):5'- GCTTTCTCCAGGAAATATGCAC -3'
Posted On2013-05-23