Incidental Mutation 'R4969:Mylk'
ID 384309
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Name myosin, light polypeptide kinase
Synonyms Mlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4969 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 34745210-35002420 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34971440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 1494 (V1494E)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: V1494E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: V1494E

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232482
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Nxf1 A G 19: 8,762,305 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7162:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
R8540:Mylk UTSW 16 34929887 missense possibly damaging 0.87
R8721:Mylk UTSW 16 34996806 missense probably damaging 1.00
R8743:Mylk UTSW 16 34921057 missense probably benign 0.03
R8798:Mylk UTSW 16 34899402 missense possibly damaging 0.89
R8956:Mylk UTSW 16 34971409 missense probably benign 0.01
R9131:Mylk UTSW 16 34956465 missense probably benign 0.29
R9403:Mylk UTSW 16 34875642 nonsense probably null
R9624:Mylk UTSW 16 34879307 missense probably benign 0.29
R9735:Mylk UTSW 16 34914809 missense probably benign 0.09
R9756:Mylk UTSW 16 34914017 missense probably damaging 0.96
R9763:Mylk UTSW 16 34879112 nonsense probably null
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAGTGTCCGATGATGGTGAG -3'
(R):5'- TCCTACAGAGCTGGGTCTGTAC -3'

Sequencing Primer
(F):5'- CCGATGATGGTGAGTGAGGCC -3'
(R):5'- TCTGTACAGAGCCACAGGAGC -3'
Posted On 2016-04-27