Mutagenetix > Incidental Mutation

Incidental Mutation 'R4969:Urb1'

384311

Institutional Source

Beutler Lab

Gene Symbol

Urb1

Ensembl Gene

ENSMUSG00000039929

Gene Name

URB1 ribosome biogenesis 1 homolog (S. cerevisiae)

Synonyms

4921511H13Rik, 5730405K23Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

90751527-90810413 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 90805411 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 90 (R90Q)

Ref Sequence

ENSEMBL: ENSMUSP00000114717 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140920]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128989

Predicted Effect

probably damaging
Transcript: ENSMUST00000140920
AA Change: R90Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000114717
Gene: ENSMUSG00000039929
AA Change: R90Q

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:Npa1	78	396	1.5e-86	PFAM
low complexity region	751	761	N/A	INTRINSIC
low complexity region	955	966	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
low complexity region	1360	1375	N/A	INTRINSIC
Pfam:NopRA1	1670	1859	3.6e-60	PFAM
low complexity region	2029	2040	N/A	INTRINSIC
low complexity region	2092	2111	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140942

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142955

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.2%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc8	A	G	7: 46,105,519	I1525T	probably benign	Het
Agtpbp1	A	G	13: 59,500,578	V476A	probably benign	Het
Aipl1	A	G	11: 72,031,430	I151T	probably benign	Het
Apc	C	T	18: 34,312,918	R938*	probably null	Het
Atp2a2	A	G	5: 122,458,491	F855S	possibly damaging	Het
Axdnd1	T	C	1: 156,395,505	T261A	possibly damaging	Het
Cbfa2t2	A	G	2: 154,523,980	D370G	probably damaging	Het
Cep350	T	C	1: 155,860,279	I2964V	probably damaging	Het
Clec16a	T	C	16: 10,568,511	V158A	probably damaging	Het
Col6a5	G	A	9: 105,864,607	T2371I	probably damaging	Het
Cpne8	T	C	15: 90,619,726	T79A	probably damaging	Het
Cyp2b13	A	G	7: 26,080,988	R145G	probably damaging	Het
Disc1	G	A	8: 125,124,550	W391*	probably null	Het
Dnah8	G	A	17: 30,723,014	V1745I	probably damaging	Het
Dsp	T	C	13: 38,192,910	V1557A	probably benign	Het
Egfem1	T	A	3: 29,582,996	Y194N	probably damaging	Het
Eif4a3	A	G	11: 119,288,879	Y361H	probably damaging	Het
Esd	T	A	14: 74,744,713	S189R	possibly damaging	Het
Fancf	A	T	7: 51,861,448	Y269*	probably null	Het
Fbln2	A	T	6: 91,271,587	H1078L	possibly damaging	Het
Fbxw13	A	G	9: 109,181,524		probably null	Het
Fcgr2b	A	T	1: 170,963,372	V284D	probably benign	Het
Fuz	G	A	7: 44,900,294	G363R	probably damaging	Het
Gas7	A	G	11: 67,683,408	E403G	probably damaging	Het
Gnl1	A	G	17: 35,980,689	D49G	possibly damaging	Het
Gucy2g	A	G	19: 55,226,013	V561A	probably benign	Het
H1fnt	A	T	15: 98,256,335	V311E	unknown	Het
Hebp2	T	C	10: 18,544,374	T104A	probably benign	Het
Ighv1-19	T	A	12: 114,708,757	Q80L	probably benign	Het
Kctd19	T	A	8: 105,396,327		probably null	Het
Kdm3b	T	C	18: 34,822,375	L905P	probably damaging	Het
Klkb1	T	C	8: 45,282,777	D183G	probably benign	Het
Krt6b	T	C	15: 101,680,025	R67G	possibly damaging	Het
Krt75	T	C	15: 101,573,813	I7V	probably benign	Het
Lpo	A	T	11: 87,806,925	N685K	probably benign	Het
Mroh7	A	T	4: 106,680,873	I1202N	probably benign	Het
Muc4	T	A	16: 32,754,572	M1482K	probably benign	Het
Mylk	T	A	16: 34,971,440	V1494E	probably damaging	Het
Neurl4	A	G	11: 69,911,087	D17G	probably damaging	Het
Nkx6-3	A	G	8: 23,157,709	Y228C	probably damaging	Het
Nprl2	G	A	9: 107,543,074		probably null	Het
Nxf1	A	G	19: 8,762,305		probably null	Het
Olfr1238	A	G	2: 89,406,426	F218L	probably benign	Het
Olfr654	A	T	7: 104,588,523	N240Y	probably damaging	Het
Pde3b	A	G	7: 114,519,612	E662G	possibly damaging	Het
Plekhm3	G	A	1: 64,937,919	R131C	probably damaging	Het
Plpp7	T	C	2: 32,095,938	S43P	probably benign	Het
Pramel5	A	G	4: 144,271,617	L352P	probably damaging	Het
Prepl	T	C	17: 85,088,474	S27G	probably benign	Het
Ptprd	A	G	4: 76,133,305	I227T	probably damaging	Het
Pttg1ip	C	T	10: 77,584,020	Q6*	probably null	Het
Rgl1	C	T	1: 152,549,062		probably null	Het
Riiad1	C	A	3: 94,472,866	G41*	probably null	Het
Rnf214	C	T	9: 45,896,188	R239H	probably damaging	Het
Rpap3	C	T	15: 97,686,526	V346I	probably benign	Het
Scaf4	G	A	16: 90,251,943	Q328*	probably null	Het
Sec23a	A	G	12: 59,004,488		probably null	Het
Slc5a8	T	A	10: 88,904,912		probably null	Het
Slc9a8	A	G	2: 167,446,529	T183A	probably benign	Het
Sod3	A	T	5: 52,368,394	H145L	probably damaging	Het
Sp4	A	G	12: 118,299,606	V235A	probably damaging	Het
Spp1	A	C	5: 104,440,287	E185A	possibly damaging	Het
Susd1	A	T	4: 59,351,679	W461R	probably benign	Het
Svil	A	C	18: 5,095,516	K1124Q	probably damaging	Het
Tdrd12	A	T	7: 35,487,295		probably null	Het
Terb1	A	T	8: 104,495,163	N168K	probably benign	Het
Tnnt1	A	G	7: 4,507,574	L216P	probably damaging	Het
Ttc28	A	G	5: 111,276,255	K1463E	probably damaging	Het
Twf2	T	G	9: 106,211,899		probably null	Het
Wdr45b	A	T	11: 121,328,824	C299*	probably null	Het
Wrap73	A	G	4: 154,152,681	S54G	probably damaging	Het
Zeb2	T	C	2: 44,998,919	K323R	probably damaging	Het
Zfp410	T	C	12: 84,331,808	I302T	possibly damaging	Het

Other mutations in Urb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00715:Urb1	APN	16	90753321	critical splice donor site	probably null
IGL00915:Urb1	APN	16	90779098	missense	possibly damaging	0.76
IGL01108:Urb1	APN	16	90792814	missense	probably damaging	1.00
IGL01122:Urb1	APN	16	90804458	missense	possibly damaging	0.81
IGL01387:Urb1	APN	16	90757761	missense	possibly damaging	0.64
IGL01484:Urb1	APN	16	90777560	missense	probably benign	0.11
IGL01606:Urb1	APN	16	90760459	missense	probably damaging	1.00
IGL01989:Urb1	APN	16	90769586	splice site	probably benign
IGL02516:Urb1	APN	16	90772695	missense	possibly damaging	0.49
IGL03018:Urb1	APN	16	90788156	missense	probably benign	0.02
IGL03165:Urb1	APN	16	90780304	missense	probably damaging	1.00
IGL03216:Urb1	APN	16	90788114	missense	probably benign	0.00
H8562:Urb1	UTSW	16	90769469	missense	probably benign	0.08
H8786:Urb1	UTSW	16	90769469	missense	probably benign	0.08
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0064:Urb1	UTSW	16	90779140	missense	probably benign
R0359:Urb1	UTSW	16	90791160	missense	probably damaging	1.00
R0386:Urb1	UTSW	16	90796399	missense	probably damaging	1.00
R0508:Urb1	UTSW	16	90783262	splice site	probably benign
R0517:Urb1	UTSW	16	90777422	nonsense	probably null
R0704:Urb1	UTSW	16	90776207	missense	probably benign	0.31
R0755:Urb1	UTSW	16	90774094	missense	probably damaging	1.00
R0755:Urb1	UTSW	16	90779138	missense	probably benign
R0783:Urb1	UTSW	16	90810297	missense	possibly damaging	0.55
R0833:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0836:Urb1	UTSW	16	90795448	missense	possibly damaging	0.89
R0970:Urb1	UTSW	16	90769447	missense	possibly damaging	0.83
R1144:Urb1	UTSW	16	90776318	splice site	probably null
R1344:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1418:Urb1	UTSW	16	90769466	missense	probably damaging	1.00
R1453:Urb1	UTSW	16	90796492	missense	probably damaging	1.00
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1470:Urb1	UTSW	16	90752014	missense	probably benign	0.34
R1520:Urb1	UTSW	16	90774745	missense	probably benign	0.00
R1521:Urb1	UTSW	16	90753863	missense	probably damaging	1.00
R1598:Urb1	UTSW	16	90777440	missense	possibly damaging	0.93
R1617:Urb1	UTSW	16	90760452	missense	possibly damaging	0.82
R1625:Urb1	UTSW	16	90774048	critical splice donor site	probably null
R1640:Urb1	UTSW	16	90772626	missense	probably benign	0.00
R1664:Urb1	UTSW	16	90788082	critical splice donor site	probably null
R1672:Urb1	UTSW	16	90787397	missense	probably damaging	1.00
R1694:Urb1	UTSW	16	90767040	missense	probably benign
R1856:Urb1	UTSW	16	90761695	missense	probably benign	0.00
R2001:Urb1	UTSW	16	90762344	missense	probably benign	0.30
R2196:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R2850:Urb1	UTSW	16	90774256	missense	probably benign	0.01
R3009:Urb1	UTSW	16	90774798	missense	probably benign	0.09
R3104:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3105:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3106:Urb1	UTSW	16	90795443	missense	probably damaging	1.00
R3160:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3162:Urb1	UTSW	16	90797903	missense	probably damaging	1.00
R3900:Urb1	UTSW	16	90783376	missense	possibly damaging	0.86
R4014:Urb1	UTSW	16	90769465	missense	probably damaging	1.00
R4036:Urb1	UTSW	16	90788086	missense	probably benign
R4332:Urb1	UTSW	16	90774537	missense	probably damaging	1.00
R4448:Urb1	UTSW	16	90769394	missense	possibly damaging	0.71
R4581:Urb1	UTSW	16	90788146	missense	probably benign	0.04
R4593:Urb1	UTSW	16	90787444	missense	probably damaging	1.00
R4610:Urb1	UTSW	16	90776271	missense	probably benign	0.43
R4659:Urb1	UTSW	16	90776129	missense	probably damaging	0.96
R4672:Urb1	UTSW	16	90772634	missense	probably benign
R4681:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R4771:Urb1	UTSW	16	90753518	missense	probably benign	0.00
R4790:Urb1	UTSW	16	90769555	nonsense	probably null
R4798:Urb1	UTSW	16	90757827	missense	probably benign	0.12
R4809:Urb1	UTSW	16	90759842	missense	possibly damaging	0.82
R4850:Urb1	UTSW	16	90795414	nonsense	probably null
R4916:Urb1	UTSW	16	90783328	missense	probably damaging	1.00
R5032:Urb1	UTSW	16	90756171	missense	probably benign	0.00
R5111:Urb1	UTSW	16	90752017	missense	probably benign	0.00
R5122:Urb1	UTSW	16	90752095	nonsense	probably null
R5184:Urb1	UTSW	16	90783274	critical splice donor site	probably null
R5199:Urb1	UTSW	16	90792748	missense	possibly damaging	0.95
R5436:Urb1	UTSW	16	90792762	missense	probably damaging	1.00
R5767:Urb1	UTSW	16	90776163	missense	probably benign	0.00
R5812:Urb1	UTSW	16	90804537	missense	probably damaging	0.99
R5872:Urb1	UTSW	16	90772764	nonsense	probably null
R6052:Urb1	UTSW	16	90762383	missense	probably damaging	1.00
R6063:Urb1	UTSW	16	90789097	missense	probably benign	0.02
R6065:Urb1	UTSW	16	90803332	missense	probably benign	0.03
R6181:Urb1	UTSW	16	90779094	missense	probably benign	0.00
R6268:Urb1	UTSW	16	90753919	missense	probably benign	0.03
R6429:Urb1	UTSW	16	90762430	splice site	probably null
R6572:Urb1	UTSW	16	90787414	missense	probably benign	0.37
R6606:Urb1	UTSW	16	90810268	missense	probably benign	0.00
R6730:Urb1	UTSW	16	90779083	missense	possibly damaging	0.89
R6838:Urb1	UTSW	16	90782106	missense	possibly damaging	0.93
R7237:Urb1	UTSW	16	90791166	missense	probably damaging	1.00
R7238:Urb1	UTSW	16	90752115	missense	possibly damaging	0.88
R7339:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7341:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7361:Urb1	UTSW	16	90774768	missense	probably damaging	0.99
R7365:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7366:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7440:Urb1	UTSW	16	90787408	missense	probably damaging	1.00
R7530:Urb1	UTSW	16	90761634	missense	probably damaging	1.00
R7553:Urb1	UTSW	16	90792864	missense	probably damaging	1.00
R7557:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7603:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7607:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7609:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7610:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7612:Urb1	UTSW	16	90797910	missense	probably damaging	1.00
R7613:Urb1	UTSW	16	90772573	critical splice donor site	probably benign
R7684:Urb1	UTSW	16	90786118	nonsense	probably null
R8029:Urb1	UTSW	16	90779152	missense	possibly damaging	0.67
R8324:Urb1	UTSW	16	90791190	missense	probably damaging	1.00
R8680:Urb1	UTSW	16	90774625	missense	probably benign	0.00
R8785:Urb1	UTSW	16	90803423	missense	probably benign	0.07
R8914:Urb1	UTSW	16	90810234	missense	probably damaging	1.00
R8959:Urb1	UTSW	16	90774117	missense	probably benign	0.26
R9005:Urb1	UTSW	16	90753790	missense	probably benign	0.01
R9126:Urb1	UTSW	16	90769402	missense	possibly damaging	0.53
R9195:Urb1	UTSW	16	90792750	missense	probably benign	0.03
R9276:Urb1	UTSW	16	90772575	splice site	probably benign
R9534:Urb1	UTSW	16	90786208	missense	possibly damaging	0.54
Z1177:Urb1	UTSW	16	90753883	missense	probably benign	0.00
Z1177:Urb1	UTSW	16	90774862	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GTTGCTGTTTTCCACAAAGGC -3'
(R):5'- CTTTGGGTGGGAGTCACTGAAC -3'

Sequencing Primer
(F):5'- TGTTTTCCACAAAGGCCACAG -3'
(R):5'- TCACTGAACAAGGAAGTATGGTG -3'

Posted On

2016-04-27