Incidental Mutation 'R4969:Nxf1'
ID384319
Institutional Source Beutler Lab
Gene Symbol Nxf1
Ensembl Gene ENSMUSG00000010097
Gene Namenuclear RNA export factor 1
SynonymsTip associated protein, Mex67, TAP, Mvb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4969 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8757073-8772475 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 8762305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010241] [ENSMUST00000183939] [ENSMUST00000184756] [ENSMUST00000184970]
Predicted Effect probably null
Transcript: ENSMUST00000010241
SMART Domains Protein: ENSMUSP00000010241
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 115 198 7.6e-42 PFAM
low complexity region 258 274 N/A INTRINSIC
LRRcap 333 351 1.44e0 SMART
Pfam:NTF2 385 535 1.3e-29 PFAM
TAP_C 555 618 1.85e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183780
Predicted Effect probably benign
Transcript: ENSMUST00000183939
SMART Domains Protein: ENSMUSP00000139351
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
Pfam:Tap-RNA_bind 1 63 5.7e-28 PFAM
low complexity region 122 138 N/A INTRINSIC
Pfam:LRR_1 155 178 2.1e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184387
Predicted Effect probably benign
Transcript: ENSMUST00000184756
SMART Domains Protein: ENSMUSP00000139050
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184970
SMART Domains Protein: ENSMUSP00000139124
Gene: ENSMUSG00000010097

DomainStartEndE-ValueType
low complexity region 33 50 N/A INTRINSIC
low complexity region 67 81 N/A INTRINSIC
Pfam:Tap-RNA_bind 112 199 2.4e-45 PFAM
low complexity region 258 274 N/A INTRINSIC
Pfam:LRR_1 291 314 3.2e-2 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185056
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one member of a family of nuclear RNA export factor genes. Common domain features of this family are a noncanonical RNP-type RNA-binding domain (RBD), 4 leucine-rich repeats (LRRs), a nuclear transport factor 2 (NTF2)-like domain that allows heterodimerization with NTF2-related export protein-1 (NXT1), and a ubiquitin-associated domain that mediates interactions with nucleoporins. The LRRs and NTF2-like domains are required for export activity. Alternative splicing seems to be a common mechanism in this gene family. The encoded protein of this gene shuttles between the nucleus and the cytoplasm and binds in vivo to poly(A)+ RNA. It is the vertebrate homologue of the yeast protein Mex67p. The encoded protein overcomes the mRNA export block caused by the presence of saturating amounts of CTE (constitutive transport element) RNA of type D retroviruses. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some alleles are able to suppress defects caused by retrovirus insertion mutations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 A G 7: 46,105,519 I1525T probably benign Het
Agtpbp1 A G 13: 59,500,578 V476A probably benign Het
Aipl1 A G 11: 72,031,430 I151T probably benign Het
Apc C T 18: 34,312,918 R938* probably null Het
Atp2a2 A G 5: 122,458,491 F855S possibly damaging Het
Axdnd1 T C 1: 156,395,505 T261A possibly damaging Het
Cbfa2t2 A G 2: 154,523,980 D370G probably damaging Het
Cep350 T C 1: 155,860,279 I2964V probably damaging Het
Clec16a T C 16: 10,568,511 V158A probably damaging Het
Col6a5 G A 9: 105,864,607 T2371I probably damaging Het
Cpne8 T C 15: 90,619,726 T79A probably damaging Het
Cyp2b13 A G 7: 26,080,988 R145G probably damaging Het
Disc1 G A 8: 125,124,550 W391* probably null Het
Dnah8 G A 17: 30,723,014 V1745I probably damaging Het
Dsp T C 13: 38,192,910 V1557A probably benign Het
Egfem1 T A 3: 29,582,996 Y194N probably damaging Het
Eif4a3 A G 11: 119,288,879 Y361H probably damaging Het
Esd T A 14: 74,744,713 S189R possibly damaging Het
Fancf A T 7: 51,861,448 Y269* probably null Het
Fbln2 A T 6: 91,271,587 H1078L possibly damaging Het
Fbxw13 A G 9: 109,181,524 probably null Het
Fcgr2b A T 1: 170,963,372 V284D probably benign Het
Fuz G A 7: 44,900,294 G363R probably damaging Het
Gas7 A G 11: 67,683,408 E403G probably damaging Het
Gnl1 A G 17: 35,980,689 D49G possibly damaging Het
Gucy2g A G 19: 55,226,013 V561A probably benign Het
H1fnt A T 15: 98,256,335 V311E unknown Het
Hebp2 T C 10: 18,544,374 T104A probably benign Het
Ighv1-19 T A 12: 114,708,757 Q80L probably benign Het
Kctd19 T A 8: 105,396,327 probably null Het
Kdm3b T C 18: 34,822,375 L905P probably damaging Het
Klkb1 T C 8: 45,282,777 D183G probably benign Het
Krt6b T C 15: 101,680,025 R67G possibly damaging Het
Krt75 T C 15: 101,573,813 I7V probably benign Het
Lpo A T 11: 87,806,925 N685K probably benign Het
Mroh7 A T 4: 106,680,873 I1202N probably benign Het
Muc4 T A 16: 32,754,572 M1482K probably benign Het
Mylk T A 16: 34,971,440 V1494E probably damaging Het
Neurl4 A G 11: 69,911,087 D17G probably damaging Het
Nkx6-3 A G 8: 23,157,709 Y228C probably damaging Het
Nprl2 G A 9: 107,543,074 probably null Het
Olfr1238 A G 2: 89,406,426 F218L probably benign Het
Olfr654 A T 7: 104,588,523 N240Y probably damaging Het
Pde3b A G 7: 114,519,612 E662G possibly damaging Het
Plekhm3 G A 1: 64,937,919 R131C probably damaging Het
Plpp7 T C 2: 32,095,938 S43P probably benign Het
Pramel5 A G 4: 144,271,617 L352P probably damaging Het
Prepl T C 17: 85,088,474 S27G probably benign Het
Ptprd A G 4: 76,133,305 I227T probably damaging Het
Pttg1ip C T 10: 77,584,020 Q6* probably null Het
Rgl1 C T 1: 152,549,062 probably null Het
Riiad1 C A 3: 94,472,866 G41* probably null Het
Rnf214 C T 9: 45,896,188 R239H probably damaging Het
Rpap3 C T 15: 97,686,526 V346I probably benign Het
Scaf4 G A 16: 90,251,943 Q328* probably null Het
Sec23a A G 12: 59,004,488 probably null Het
Slc5a8 T A 10: 88,904,912 probably null Het
Slc9a8 A G 2: 167,446,529 T183A probably benign Het
Sod3 A T 5: 52,368,394 H145L probably damaging Het
Sp4 A G 12: 118,299,606 V235A probably damaging Het
Spp1 A C 5: 104,440,287 E185A possibly damaging Het
Susd1 A T 4: 59,351,679 W461R probably benign Het
Svil A C 18: 5,095,516 K1124Q probably damaging Het
Tdrd12 A T 7: 35,487,295 probably null Het
Terb1 A T 8: 104,495,163 N168K probably benign Het
Tnnt1 A G 7: 4,507,574 L216P probably damaging Het
Ttc28 A G 5: 111,276,255 K1463E probably damaging Het
Twf2 T G 9: 106,211,899 probably null Het
Urb1 C T 16: 90,805,411 R90Q probably damaging Het
Wdr45b A T 11: 121,328,824 C299* probably null Het
Wrap73 A G 4: 154,152,681 S54G probably damaging Het
Zeb2 T C 2: 44,998,919 K323R probably damaging Het
Zfp410 T C 12: 84,331,808 I302T possibly damaging Het
Other mutations in Nxf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Nxf1 APN 19 8762742 missense possibly damaging 0.95
IGL02318:Nxf1 APN 19 8764150 critical splice donor site probably null
IGL03383:Nxf1 APN 19 8763697 missense probably damaging 1.00
Chance UTSW 19 8769182 missense probably damaging 1.00
Possibility UTSW 19 8767744 missense probably damaging 1.00
Probability UTSW 19 8764317 missense probably benign 0.01
R0125:Nxf1 UTSW 19 8762806 missense probably benign 0.37
R0362:Nxf1 UTSW 19 8764151 critical splice donor site probably null
R0374:Nxf1 UTSW 19 8767739 missense possibly damaging 0.86
R0403:Nxf1 UTSW 19 8765028 missense probably damaging 1.00
R0883:Nxf1 UTSW 19 8764591 missense probably damaging 1.00
R1004:Nxf1 UTSW 19 8764317 missense probably benign 0.01
R1068:Nxf1 UTSW 19 8762754 missense probably damaging 0.97
R1503:Nxf1 UTSW 19 8762436 missense probably benign
R1669:Nxf1 UTSW 19 8772131 missense possibly damaging 0.93
R1679:Nxf1 UTSW 19 8769074 missense probably benign
R4424:Nxf1 UTSW 19 8766764 utr 3 prime probably benign
R4608:Nxf1 UTSW 19 8762763 missense probably benign 0.03
R4783:Nxf1 UTSW 19 8766798 missense probably benign 0.01
R5233:Nxf1 UTSW 19 8763929 missense possibly damaging 0.67
R5370:Nxf1 UTSW 19 8772140 missense probably damaging 1.00
R6024:Nxf1 UTSW 19 8767744 missense probably damaging 1.00
R6058:Nxf1 UTSW 19 8767822 missense probably damaging 1.00
R6063:Nxf1 UTSW 19 8767787 missense possibly damaging 0.46
R6293:Nxf1 UTSW 19 8769182 missense probably damaging 1.00
R6378:Nxf1 UTSW 19 8764546 missense probably benign 0.19
R8170:Nxf1 UTSW 19 8771050 missense probably benign 0.02
R8317:Nxf1 UTSW 19 8771043 missense probably benign
RF021:Nxf1 UTSW 19 8772309 missense probably damaging 1.00
X0024:Nxf1 UTSW 19 8763764 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAATAACTTGTTCACGATGTGG -3'
(R):5'- AGTGGGTCACTATTCAAAGCAGAC -3'

Sequencing Primer
(F):5'- TGTTCACGATGTGGATGTAATAAAG -3'
(R):5'- ATCTTACTCGGGGGCCATC -3'
Posted On2016-04-27