Mutagenetix > Incidental Mutations

Incidental Mutation 'R4970:Cfap57'

384356

Institutional Source

Beutler Lab

Gene Symbol

Cfap57

Ensembl Gene

ENSMUSG00000028730

Gene Name

cilia and flagella associated protein 57

Synonyms

Wdr65, 1110020C03Rik, C130004B06Rik, LOC384050

MMRRC Submission

042565-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118554551-118620777 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 118620371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 12 (F12S)

Ref Sequence

ENSEMBL: ENSMUSP00000080592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030501] [ENSMUST00000071972] [ENSMUST00000081921] [ENSMUST00000147373]

AlphaFold

Q9D180

Predicted Effect

probably benign
Transcript: ENSMUST00000030501

SMART Domains

Protein: ENSMUSP00000030501
Gene: ENSMUSG00000028729

Domain	Start	End	E-Value	Type
Pfam:Ebp2	18	298	2.1e-89	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000071972
AA Change: F12S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: F12S

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000081921
AA Change: F12S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: F12S

Domain	Start	End	E-Value	Type
Blast:WD40	44	88	3e-12	BLAST
Blast:WD40	95	137	1e-9	BLAST
WD40	140	181	1.77e2	SMART
internal_repeat_1	182	237	7.23e-5	PROSPERO
WD40	329	365	1.27e2	SMART
WD40	376	416	3.4e-2	SMART
WD40	418	456	1.59e1	SMART
Blast:WD40	461	497	4e-18	BLAST
WD40	500	539	9.67e-7	SMART
WD40	544	581	3.96e1	SMART
Blast:WD40	582	621	8e-16	BLAST
WD40	626	665	3.21e-1	SMART
coiled coil region	690	1056	N/A	INTRINSIC
coiled coil region	1094	1166	N/A	INTRINSIC
coiled coil region	1197	1222	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126458

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130219

Predicted Effect

probably benign
Transcript: ENSMUST00000147373

SMART Domains

Protein: ENSMUSP00000114372
Gene: ENSMUSG00000028729

Domain	Start	End	E-Value	Type
Pfam:Ebp2	13	187	4.8e-65	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149837

Meta Mutation Damage Score

0.8376

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (114/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,222,065		noncoding transcript	Het
Aars	A	G	8: 111,043,679	M370V	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acad9	A	T	3: 36,085,525	I425F	probably damaging	Het
Adhfe1	C	A	1: 9,558,238	D278E	possibly damaging	Het
Afg3l1	G	A	8: 123,498,653	V532I	probably benign	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Asah1	G	T	8: 41,360,277	S33*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Bag4	A	T	8: 25,771,244	Y156*	probably null	Het
Bmpr1b	T	C	3: 141,845,187	E381G	probably damaging	Het
Btnl7-ps	A	G	17: 34,537,118		noncoding transcript	Het
Caap1	A	T	4: 94,521,060		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Ccp110	T	C	7: 118,722,391	V423A	possibly damaging	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Clvs1	A	G	4: 9,350,857		probably benign	Het
Dgkh	A	T	14: 78,618,637	V199E	probably damaging	Het
Dhx32	T	A	7: 133,738,655		probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Efcab7	C	A	4: 99,831,543	S87R	probably damaging	Het
Fam81a	G	A	9: 70,093,590	Q291*	probably null	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gm10313	A	T	8: 46,255,425		noncoding transcript	Het
Gm1966	A	T	7: 106,600,657		noncoding transcript	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm5535	T	A	2: 144,174,649		noncoding transcript	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Igfbp7	A	G	5: 77,407,761	M85T	possibly damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Itch	T	C	2: 155,185,593	F379L	possibly damaging	Het
Itgad	T	A	7: 128,189,843	V488D	possibly damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Kirrel3	A	G	9: 34,944,439	E92G	possibly damaging	Het
Lpin2	T	C	17: 71,231,334	V325A	probably damaging	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Lrch3	T	C	16: 32,998,513	Y661H	probably damaging	Het
Lrfn5	C	A	12: 61,839,675	S83Y	probably damaging	Het
Lrp1	A	C	10: 127,539,520	L4435R	probably benign	Het
Lrrn1	A	G	6: 107,569,344	D701G	probably benign	Het
Map4k3	A	T	17: 80,653,903	Y125N	probably benign	Het
Mau2	A	T	8: 70,027,703	H273Q	possibly damaging	Het
Med16	A	C	10: 79,907,037		probably null	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr619	T	C	7: 103,603,990	I112T	probably damaging	Het
Olfr711	T	A	7: 106,971,571	M258L	probably benign	Het
Olfr937	A	T	9: 39,060,531	M45K	probably benign	Het
Pcdhb20	T	A	18: 37,506,771	N783K	probably benign	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Pdyn	T	A	2: 129,688,101	D216V	probably damaging	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Polrmt	G	T	10: 79,736,587	H1145N	probably damaging	Het
Proser1	A	G	3: 53,464,306	D11G	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Ptprn2	G	A	12: 117,276,595	E991K	probably damaging	Het
Pwp2	A	C	10: 78,173,693	L797R	possibly damaging	Het
Rbm20	G	A	19: 53,851,669	A1030T	probably damaging	Het
Rdh7	T	C	10: 127,885,822	Y195C	probably benign	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Senp8	A	C	9: 59,737,221	D204E	probably benign	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sh2b1	T	A	7: 126,468,803	R560W	probably damaging	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a9	A	T	4: 117,856,008	Y60F	probably damaging	Het
Slfn10-ps	C	T	11: 83,030,381		noncoding transcript	Het
Spata31d1d	G	A	13: 59,727,520	H734Y	probably benign	Het
Spsb1	T	A	4: 149,907,155		probably benign	Het
Sptbn5	T	A	2: 120,051,777		noncoding transcript	Het
Sugp2	G	A	8: 70,259,812	V1026I	possibly damaging	Het
Syt14	T	A	1: 192,930,977		probably benign	Het
Sytl1	G	A	4: 133,255,582	Q373*	probably null	Het
Tex43	G	T	18: 56,592,422	M46I	possibly damaging	Het
Trim38	T	A	13: 23,791,329	L417Q	probably damaging	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn1r225	G	A	17: 20,502,569	G91S	possibly damaging	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Wnk1	A	T	6: 119,965,735		probably benign	Het
Zfp239	A	G	6: 117,870,517		probably benign	Het
Zfp688	T	C	7: 127,419,155	Y266C	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het
Zscan29	T	C	2: 121,169,195		probably null	Het

Other mutations in Cfap57

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Cfap57	APN	4	118581001	missense	probably benign	0.01
IGL00508:Cfap57	APN	4	118581170	splice site	probably null
IGL00857:Cfap57	APN	4	118612923	critical splice donor site	probably null
IGL01147:Cfap57	APN	4	118589001	missense	probably damaging	0.97
IGL01396:Cfap57	APN	4	118610595	missense	probably damaging	1.00
IGL01420:Cfap57	APN	4	118612940	missense	probably benign	0.21
IGL01615:Cfap57	APN	4	118600796	missense	probably damaging	1.00
IGL02154:Cfap57	APN	4	118613017	missense	probably damaging	1.00
IGL02161:Cfap57	APN	4	118579372	missense	possibly damaging	0.75
IGL02481:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02483:Cfap57	APN	4	118581105	missense	probably damaging	1.00
IGL02503:Cfap57	APN	4	118569348	critical splice donor site	probably null
IGL02800:Cfap57	APN	4	118614750	missense	probably damaging	1.00
IGL03083:Cfap57	APN	4	118584739	missense	probably damaging	0.96
IGL03146:Cfap57	APN	4	118599019	missense	probably damaging	1.00
IGL03246:Cfap57	APN	4	118576645	missense	probably benign	0.29
IGL03376:Cfap57	APN	4	118584720	missense	probably damaging	0.96
G1Funyon:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R0144:Cfap57	UTSW	4	118584705	missense	probably damaging	1.00
R0184:Cfap57	UTSW	4	118599012	missense	probably damaging	1.00
R0415:Cfap57	UTSW	4	118569431	missense	possibly damaging	0.89
R0515:Cfap57	UTSW	4	118620402	missense	probably damaging	1.00
R0690:Cfap57	UTSW	4	118569727	splice site	probably benign
R0730:Cfap57	UTSW	4	118612920	splice site	probably null
R0737:Cfap57	UTSW	4	118581102	missense	possibly damaging	0.81
R0854:Cfap57	UTSW	4	118561872	missense	probably benign	0.04
R0880:Cfap57	UTSW	4	118581838	nonsense	probably null
R1085:Cfap57	UTSW	4	118595779	missense	probably benign	0.20
R1119:Cfap57	UTSW	4	118606676	nonsense	probably null
R1217:Cfap57	UTSW	4	118606652	missense	possibly damaging	0.67
R1294:Cfap57	UTSW	4	118606534	critical splice donor site	probably null
R1487:Cfap57	UTSW	4	118614781	missense	probably benign	0.01
R1676:Cfap57	UTSW	4	118595940	missense	probably damaging	1.00
R1688:Cfap57	UTSW	4	118569646	missense	probably null	0.20
R1709:Cfap57	UTSW	4	118571704	missense	probably benign	0.00
R1719:Cfap57	UTSW	4	118606631	missense	probably benign	0.04
R1782:Cfap57	UTSW	4	118614975	missense	probably damaging	0.98
R1791:Cfap57	UTSW	4	118571724	missense	possibly damaging	0.66
R1850:Cfap57	UTSW	4	118599894	missense	probably damaging	1.00
R1866:Cfap57	UTSW	4	118599927	missense	possibly damaging	0.49
R1912:Cfap57	UTSW	4	118615010	missense	probably damaging	0.96
R1978:Cfap57	UTSW	4	118593132	missense	probably benign	0.03
R2177:Cfap57	UTSW	4	118606688	missense	probably benign	0.00
R2322:Cfap57	UTSW	4	118610725	missense	probably benign
R3905:Cfap57	UTSW	4	118595839	missense	probably damaging	1.00
R4013:Cfap57	UTSW	4	118593143	missense	probably benign	0.01
R4079:Cfap57	UTSW	4	118598997	missense	probably benign	0.34
R4962:Cfap57	UTSW	4	118613065	missense	probably benign	0.21
R4974:Cfap57	UTSW	4	118593054	missense	probably damaging	1.00
R4999:Cfap57	UTSW	4	118595848	missense	probably benign	0.01
R5482:Cfap57	UTSW	4	118569641	missense	probably benign
R5522:Cfap57	UTSW	4	118595888	missense	probably benign	0.41
R5626:Cfap57	UTSW	4	118614783	missense	probably damaging	1.00
R5685:Cfap57	UTSW	4	118569459	missense	probably benign
R5712:Cfap57	UTSW	4	118614795	missense	probably damaging	1.00
R5961:Cfap57	UTSW	4	118571745	missense	probably benign	0.00
R6244:Cfap57	UTSW	4	118579410	missense	probably damaging	0.99
R6268:Cfap57	UTSW	4	118569451	nonsense	probably null
R6271:Cfap57	UTSW	4	118595759	missense	probably benign	0.13
R6330:Cfap57	UTSW	4	118569396	missense	probably benign
R6439:Cfap57	UTSW	4	118588975	critical splice donor site	probably null
R6639:Cfap57	UTSW	4	118554712	missense	probably benign	0.13
R6722:Cfap57	UTSW	4	118584717	missense	probably damaging	1.00
R7033:Cfap57	UTSW	4	118613126	missense	possibly damaging	0.67
R7143:Cfap57	UTSW	4	118620709	unclassified	probably benign
R7162:Cfap57	UTSW	4	118614931	missense	probably benign
R7174:Cfap57	UTSW	4	118589067	missense	probably benign	0.35
R7210:Cfap57	UTSW	4	118576703	nonsense	probably null
R7242:Cfap57	UTSW	4	118593096	missense	possibly damaging	0.50
R7244:Cfap57	UTSW	4	118554800	nonsense	probably null
R7359:Cfap57	UTSW	4	118598965	missense	probably benign	0.01
R7373:Cfap57	UTSW	4	118614931	missense	probably benign
R7394:Cfap57	UTSW	4	118593137	missense	probably benign	0.00
R7401:Cfap57	UTSW	4	118614931	missense	probably benign
R7412:Cfap57	UTSW	4	118614931	missense	probably benign
R7414:Cfap57	UTSW	4	118614931	missense	probably benign
R7452:Cfap57	UTSW	4	118595784	missense	probably damaging	1.00
R7457:Cfap57	UTSW	4	118589001	missense	probably damaging	0.97
R7559:Cfap57	UTSW	4	118614931	missense	probably benign
R7642:Cfap57	UTSW	4	118614931	missense	probably benign
R7741:Cfap57	UTSW	4	118614931	missense	probably benign
R7744:Cfap57	UTSW	4	118614931	missense	probably benign
R7745:Cfap57	UTSW	4	118614931	missense	probably benign
R7842:Cfap57	UTSW	4	118554755	nonsense	probably null
R7936:Cfap57	UTSW	4	118614931	missense	probably benign
R7940:Cfap57	UTSW	4	118614931	missense	probably benign
R7942:Cfap57	UTSW	4	118614931	missense	probably benign
R8074:Cfap57	UTSW	4	118569625	missense	possibly damaging	0.66
R8301:Cfap57	UTSW	4	118593074	missense	possibly damaging	0.94
R8411:Cfap57	UTSW	4	118614931	missense	probably benign
R8447:Cfap57	UTSW	4	118614931	missense	probably benign
R8491:Cfap57	UTSW	4	118614931	missense	probably benign
R8524:Cfap57	UTSW	4	118614931	missense	probably benign
R8670:Cfap57	UTSW	4	118614925	missense	possibly damaging	0.91
R8707:Cfap57	UTSW	4	118593006	missense	probably benign	0.04
R8790:Cfap57	UTSW	4	118581914	missense	possibly damaging	0.59
R8941:Cfap57	UTSW	4	118569602	missense	probably damaging	0.99
R9139:Cfap57	UTSW	4	118554851	missense	probably benign	0.02
R9212:Cfap57	UTSW	4	118579452	missense	possibly damaging	0.95
X0022:Cfap57	UTSW	4	118614745	missense	probably benign
Z1088:Cfap57	UTSW	4	118581882	missense	probably benign	0.22
Z1177:Cfap57	UTSW	4	118598956	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CGGTTTTGTGTAGCACATGC -3'
(R):5'- AATAGTTTCTTTGGGGTCCTCC -3'

Sequencing Primer
(F):5'- GCACATGCCTTTAATGTATGTGTCAG -3'
(R):5'- TCCTAAGGATCTGAGGGCG -3'

Posted On

2016-04-27