Incidental Mutation 'R0347:Tecrl'
ID38439
Institutional Source Beutler Lab
Gene Symbol Tecrl
Ensembl Gene ENSMUSG00000049537
Gene Nametrans-2,3-enoyl-CoA reductase-like
SynonymsSrd5a2l2, D330017N19Rik
MMRRC Submission 038554-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R0347 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location83278145-83355195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83294632 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 198 (E198G)
Ref Sequence ENSEMBL: ENSMUSP00000062122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053543]
Predicted Effect probably damaging
Transcript: ENSMUST00000053543
AA Change: E198G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062122
Gene: ENSMUSG00000049537
AA Change: E198G

DomainStartEndE-ValueType
PDB:2DZJ|A 53 135 1e-17 PDB
Blast:UBQ 59 135 2e-7 BLAST
transmembrane domain 139 161 N/A INTRINSIC
Pfam:Steroid_dh 208 361 3.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117478
Predicted Effect unknown
Transcript: ENSMUST00000146669
AA Change: E158G
SMART Domains Protein: ENSMUSP00000115144
Gene: ENSMUSG00000049537
AA Change: E158G

DomainStartEndE-ValueType
PDB:2DZJ|A 39 93 1e-11 PDB
transmembrane domain 100 122 N/A INTRINSIC
Meta Mutation Damage Score 0.8391 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 91.8%
Validation Efficiency 100% (78/78)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik A T 10: 77,984,422 I209F probably damaging Het
5830411N06Rik T A 7: 140,297,854 H800Q probably damaging Het
Abca4 A G 3: 122,120,099 E908G probably benign Het
Abcb5 T A 12: 118,965,251 probably benign Het
Adhfe1 T A 1: 9,553,430 F102Y probably benign Het
Aff4 A G 11: 53,400,088 Y625C probably benign Het
Alox5 T C 6: 116,413,552 E488G possibly damaging Het
Ankmy2 T C 12: 36,193,754 C323R probably damaging Het
Ankrd28 A G 14: 31,702,022 *1084R probably null Het
Apol10a A T 15: 77,488,691 I176F probably damaging Het
Arhgap26 C T 18: 38,617,744 T70I unknown Het
Arid2 A G 15: 96,370,952 N982S probably benign Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Camsap3 A G 8: 3,602,029 D291G probably damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Cdc20b G T 13: 113,059,827 G162V probably damaging Het
Cep44 T G 8: 56,545,475 E56A probably damaging Het
Cfap65 A G 1: 74,926,444 L469P probably damaging Het
Cilp T A 9: 65,280,153 C1177S probably benign Het
Ctnnbip1 C T 4: 149,545,754 P7S probably damaging Het
Cyp11a1 T C 9: 58,016,260 probably benign Het
Cyp3a11 C T 5: 145,865,925 V253M possibly damaging Het
D630045J12Rik C A 6: 38,181,392 V1117L probably damaging Het
Dnah7b T A 1: 46,240,944 S2678T probably damaging Het
Dock1 T C 7: 134,763,867 I428T probably damaging Het
Fam83f A G 15: 80,672,257 D114G probably damaging Het
Flt3 T A 5: 147,357,992 N423I probably damaging Het
Fnbp1l A T 3: 122,590,175 F31L probably damaging Het
Glrx3 G A 7: 137,437,701 E10K unknown Het
Gm12185 T C 11: 48,915,182 E394G probably benign Het
Gm15448 A T 7: 3,822,874 V332E probably damaging Het
Gpatch1 C T 7: 35,297,631 V381M probably benign Het
Grm8 T C 6: 27,981,222 S230G probably benign Het
Heyl A T 4: 123,233,940 D25V probably benign Het
Junb G A 8: 84,978,478 probably benign Het
Klhl29 C A 12: 5,084,354 V747F probably damaging Het
Krt77 T C 15: 101,859,869 H569R unknown Het
Ldhb T C 6: 142,494,133 N227S probably benign Het
Megf6 A G 4: 154,254,635 D543G possibly damaging Het
Mrps23 A T 11: 88,210,693 Q136L probably benign Het
Myh2 C T 11: 67,185,304 probably benign Het
Nadk2 T A 15: 9,084,207 D133E probably benign Het
Neurod4 G A 10: 130,271,111 T98I probably damaging Het
Nfatc2 G T 2: 168,536,290 T465K probably damaging Het
Nipbl A G 15: 8,350,732 S859P probably benign Het
Nipsnap3a T C 4: 52,997,155 probably benign Het
Nlrp4c A G 7: 6,066,416 K439E possibly damaging Het
Olfr1419 A T 19: 11,870,433 L261H probably damaging Het
Olfr392 C T 11: 73,814,311 G257D probably damaging Het
Olfr434 T C 6: 43,217,362 F150L probably benign Het
Pds5b T A 5: 150,736,427 probably benign Het
Plch1 A G 3: 63,753,316 M282T probably damaging Het
Plch2 C A 4: 154,986,721 R1067L possibly damaging Het
Pou2f2 A C 7: 25,097,701 F206V probably damaging Het
Prss50 A G 9: 110,862,350 I49V probably damaging Het
Rexo5 T A 7: 119,823,896 probably null Het
Rgl2 C T 17: 33,932,738 T252I probably damaging Het
Rp1l1 A T 14: 64,030,804 K1280* probably null Het
Rpl24 T A 16: 55,970,177 probably null Het
Satb1 T A 17: 51,739,906 K763* probably null Het
Sema6a T A 18: 47,291,129 R237S probably damaging Het
Spg11 T C 2: 122,097,369 T645A probably damaging Het
Srrt T A 5: 137,299,676 probably benign Het
Tanc1 T C 2: 59,842,991 V1480A probably benign Het
Tbc1d2 T C 4: 46,620,574 D412G possibly damaging Het
Tigd4 A G 3: 84,593,860 D28G probably damaging Het
Trp53bp2 T G 1: 182,441,648 L226V probably benign Het
Ttll13 T C 7: 80,260,505 S799P possibly damaging Het
Vps13c A T 9: 67,910,233 Q1062H possibly damaging Het
Wnt10a T G 1: 74,793,543 H98Q probably damaging Het
Zfp651 C T 9: 121,763,102 P198S probably damaging Het
Zfp959 T A 17: 55,897,180 Y69* probably null Het
Znrd1as T A 17: 36,965,315 M114K probably damaging Het
Other mutations in Tecrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Tecrl APN 5 83294606 missense probably benign
IGL02067:Tecrl APN 5 83284275 missense probably benign 0.05
IGL02111:Tecrl APN 5 83354792 missense probably damaging 1.00
IGL02391:Tecrl APN 5 83354827 missense probably benign 0.00
IGL02860:Tecrl APN 5 83354997 missense probably benign 0.01
IGL03079:Tecrl APN 5 83294600 missense probably damaging 0.96
IGL03109:Tecrl APN 5 83309309 intron probably benign
R0095:Tecrl UTSW 5 83294570 splice site probably benign
R0372:Tecrl UTSW 5 83294659 missense probably damaging 1.00
R0403:Tecrl UTSW 5 83354758 splice site probably benign
R0426:Tecrl UTSW 5 83354763 splice site probably benign
R0597:Tecrl UTSW 5 83354928 nonsense probably null
R1607:Tecrl UTSW 5 83280508 splice site probably null
R1771:Tecrl UTSW 5 83291287 missense probably damaging 1.00
R1800:Tecrl UTSW 5 83279230 missense probably damaging 1.00
R1815:Tecrl UTSW 5 83279234 missense probably benign 0.01
R1869:Tecrl UTSW 5 83354859 missense probably benign 0.00
R1870:Tecrl UTSW 5 83354859 missense probably benign 0.00
R4296:Tecrl UTSW 5 83313327 nonsense probably null
R4471:Tecrl UTSW 5 83313287 missense probably benign
R6281:Tecrl UTSW 5 83294606 missense probably damaging 1.00
R6343:Tecrl UTSW 5 83294600 missense probably damaging 0.96
R6866:Tecrl UTSW 5 83313314 missense probably damaging 1.00
R6948:Tecrl UTSW 5 83309250 missense probably benign
R6971:Tecrl UTSW 5 83354802 missense possibly damaging 0.58
R6981:Tecrl UTSW 5 83354921 missense possibly damaging 0.83
R7246:Tecrl UTSW 5 83279335 missense probably damaging 0.99
R7282:Tecrl UTSW 5 83354907 missense probably benign 0.26
R7444:Tecrl UTSW 5 83355068 unclassified probably benign
R7900:Tecrl UTSW 5 83279341 missense probably benign 0.04
R7983:Tecrl UTSW 5 83279341 missense probably benign 0.04
X0019:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0024:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0034:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0035:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0036:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0037:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0038:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0039:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0040:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0052:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0053:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0054:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0058:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0060:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0061:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0062:Tecrl UTSW 5 83338252 missense probably benign 0.32
X0063:Tecrl UTSW 5 83338252 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCCTTGGCTTATTTCAGGGAGACAT -3'
(R):5'- TTTTCTGTGGCAGAGCAGAGCAA -3'

Sequencing Primer
(F):5'- ctctttctctttctctctcccc -3'
(R):5'- ACAGAGGGAATTATGTGCTCAG -3'
Posted On2013-05-23