Mutagenetix > Incidental Mutation

Incidental Mutation 'R4970:Il20ra'

384394

Institutional Source

Beutler Lab

Gene Symbol

Il20ra

Ensembl Gene

ENSMUSG00000020007

Gene Name

interleukin 20 receptor, alpha

Synonyms

MMRRC Submission

042565-MU

Accession Numbers

Ncbi RefSeq: NM_172786.2; MGI:3605069

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19712570-19760053 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19758943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 311 (T311A)

Ref Sequence

ENSEMBL: ENSMUSP00000020185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]

AlphaFold

Q6PHB0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020185
AA Change: T311A

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T311A

Domain	Start	End	E-Value	Type
Pfam:Tissue_fac	16	126	1.8e-33	PFAM
Pfam:Interfer-bind	138	243	4.6e-23	PFAM
transmembrane domain	255	277	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000217389

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (114/115)

MGI Phenotype

Strain: 5302406
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,222,065		noncoding transcript	Het
Aars	A	G	8: 111,043,679	M370V	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acad9	A	T	3: 36,085,525	I425F	probably damaging	Het
Adhfe1	C	A	1: 9,558,238	D278E	possibly damaging	Het
Afg3l1	G	A	8: 123,498,653	V532I	probably benign	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Asah1	G	T	8: 41,360,277	S33*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Bag4	A	T	8: 25,771,244	Y156*	probably null	Het
Bmpr1b	T	C	3: 141,845,187	E381G	probably damaging	Het
Btnl7-ps	A	G	17: 34,537,118		noncoding transcript	Het
Caap1	A	T	4: 94,521,060		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Ccp110	T	C	7: 118,722,391	V423A	possibly damaging	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Cfap57	A	G	4: 118,620,371	F12S	probably damaging	Het
Clvs1	A	G	4: 9,350,857		probably benign	Het
Dgkh	A	T	14: 78,618,637	V199E	probably damaging	Het
Dhx32	T	A	7: 133,738,655		probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Efcab7	C	A	4: 99,831,543	S87R	probably damaging	Het
Fam81a	G	A	9: 70,093,590	Q291*	probably null	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gm10313	A	T	8: 46,255,425		noncoding transcript	Het
Gm1966	A	T	7: 106,600,657		noncoding transcript	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm5535	T	A	2: 144,174,649		noncoding transcript	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Igfbp7	A	G	5: 77,407,761	M85T	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Itch	T	C	2: 155,185,593	F379L	possibly damaging	Het
Itgad	T	A	7: 128,189,843	V488D	possibly damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Kirrel3	A	G	9: 34,944,439	E92G	possibly damaging	Het
Lpin2	T	C	17: 71,231,334	V325A	probably damaging	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Lrch3	T	C	16: 32,998,513	Y661H	probably damaging	Het
Lrfn5	C	A	12: 61,839,675	S83Y	probably damaging	Het
Lrp1	A	C	10: 127,539,520	L4435R	probably benign	Het
Lrrn1	A	G	6: 107,569,344	D701G	probably benign	Het
Map4k3	A	T	17: 80,653,903	Y125N	probably benign	Het
Mau2	A	T	8: 70,027,703	H273Q	possibly damaging	Het
Med16	A	C	10: 79,907,037		probably null	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr619	T	C	7: 103,603,990	I112T	probably damaging	Het
Olfr711	T	A	7: 106,971,571	M258L	probably benign	Het
Olfr937	A	T	9: 39,060,531	M45K	probably benign	Het
Pcdhb20	T	A	18: 37,506,771	N783K	probably benign	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Pdyn	T	A	2: 129,688,101	D216V	probably damaging	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Polrmt	G	T	10: 79,736,587	H1145N	probably damaging	Het
Proser1	A	G	3: 53,464,306	D11G	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Ptprn2	G	A	12: 117,276,595	E991K	probably damaging	Het
Pwp2	A	C	10: 78,173,693	L797R	possibly damaging	Het
Rbm20	G	A	19: 53,851,669	A1030T	probably damaging	Het
Rdh7	T	C	10: 127,885,822	Y195C	probably benign	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Senp8	A	C	9: 59,737,221	D204E	probably benign	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sh2b1	T	A	7: 126,468,803	R560W	probably damaging	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a9	A	T	4: 117,856,008	Y60F	probably damaging	Het
Slfn10-ps	C	T	11: 83,030,381		noncoding transcript	Het
Spata31d1d	G	A	13: 59,727,520	H734Y	probably benign	Het
Spsb1	T	A	4: 149,907,155		probably benign	Het
Sptbn5	T	A	2: 120,051,777		noncoding transcript	Het
Sugp2	G	A	8: 70,259,812	V1026I	possibly damaging	Het
Syt14	T	A	1: 192,930,977		probably benign	Het
Sytl1	G	A	4: 133,255,582	Q373*	probably null	Het
Tex43	G	T	18: 56,592,422	M46I	possibly damaging	Het
Trim38	T	A	13: 23,791,329	L417Q	probably damaging	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn1r225	G	A	17: 20,502,569	G91S	possibly damaging	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Wnk1	A	T	6: 119,965,735		probably benign	Het
Zfp239	A	G	6: 117,870,517		probably benign	Het
Zfp688	T	C	7: 127,419,155	Y266C	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het
Zscan29	T	C	2: 121,169,195		probably null	Het

Other mutations in Il20ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01929:Il20ra	APN	10	19759271	missense	probably benign	0.01
IGL01936:Il20ra	APN	10	19755843	missense	probably damaging	1.00
IGL01958:Il20ra	APN	10	19759043	missense	probably benign	0.39
IGL02109:Il20ra	APN	10	19759505	missense	possibly damaging	0.80
IGL02207:Il20ra	APN	10	19751578	missense	probably damaging	0.99
IGL02234:Il20ra	APN	10	19749270	missense	probably damaging	1.00
IGL02959:Il20ra	APN	10	19759041	missense	probably benign	0.10
IGL03010:Il20ra	APN	10	19749212	missense	probably damaging	1.00
P0017:Il20ra	UTSW	10	19759406	missense	probably damaging	1.00
R0518:Il20ra	UTSW	10	19759640	missense	probably damaging	1.00
R0521:Il20ra	UTSW	10	19759640	missense	probably damaging	1.00
R1436:Il20ra	UTSW	10	19749252	missense	probably damaging	1.00
R1714:Il20ra	UTSW	10	19755828	missense	probably damaging	0.98
R1792:Il20ra	UTSW	10	19759636	missense	probably damaging	0.99
R1852:Il20ra	UTSW	10	19743019	missense	probably damaging	1.00
R2097:Il20ra	UTSW	10	19759463	missense	probably damaging	1.00
R4559:Il20ra	UTSW	10	19749284	missense	probably damaging	0.99
R5112:Il20ra	UTSW	10	19758943	missense	possibly damaging	0.61
R5267:Il20ra	UTSW	10	19749359	missense	probably damaging	0.99
R6543:Il20ra	UTSW	10	19749323	missense	probably damaging	1.00
R6755:Il20ra	UTSW	10	19750794	missense	probably benign	0.15
R6845:Il20ra	UTSW	10	19759311	missense	probably benign	0.06
R7014:Il20ra	UTSW	10	19712710	missense	unknown
R7190:Il20ra	UTSW	10	19742941	missense	probably damaging	0.99
R8134:Il20ra	UTSW	10	19750704	missense	probably damaging	0.99
R8955:Il20ra	UTSW	10	19759412	missense	possibly damaging	0.57
R9104:Il20ra	UTSW	10	19759616	missense	probably benign	0.21
R9439:Il20ra	UTSW	10	19743003	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTTTCTCTACGTGCCAAAC -3'
(R):5'- TTTGCTCAGCACCACAGACAG -3'

Sequencing Primer
(F):5'- GCTTTCTCTACGTGCCAAACATAAC -3'
(R):5'- GCGTCCATCAAATGCGAAG -3'

Posted On

2016-04-27