Incidental Mutation 'R4970:Il20ra'
ID 384394
Institutional Source Beutler Lab
Gene Symbol Il20ra
Ensembl Gene ENSMUSG00000020007
Gene Name interleukin 20 receptor, alpha
Synonyms
MMRRC Submission 042565-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4970 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 19588318-19635801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19634691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 311 (T311A)
Ref Sequence ENSEMBL: ENSMUSP00000020185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020185] [ENSMUST00000217389]
AlphaFold Q6PHB0
Predicted Effect possibly damaging
Transcript: ENSMUST00000020185
AA Change: T311A

PolyPhen 2 Score 0.612 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000020185
Gene: ENSMUSG00000020007
AA Change: T311A

DomainStartEndE-ValueType
Pfam:Tissue_fac 16 126 1.8e-33 PFAM
Pfam:Interfer-bind 138 243 4.6e-23 PFAM
transmembrane domain 255 277 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217389
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type II cytokine receptor family. The encoded protein is a subunit of the receptor for interleukin 20, a cytokine that may be involved in epidermal function. The interleukin 20 receptor is a heterodimeric complex consisting of the encoded protein and interleukin 20 receptor beta. This gene and interleukin 20 receptor beta are highly expressed in skin, and are upregulated in psoriasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased bone mineral density, impaired osteoclast differentiation, and resistance to ovariectomized-inducced bone loss. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,066 (GRCm39) noncoding transcript Het
Aars1 A G 8: 111,770,311 (GRCm39) M370V probably benign Het
Abca2 A G 2: 25,328,383 (GRCm39) K846R probably damaging Het
Acad9 A T 3: 36,139,674 (GRCm39) I425F probably damaging Het
Adhfe1 C A 1: 9,628,463 (GRCm39) D278E possibly damaging Het
Afg3l1 G A 8: 124,225,392 (GRCm39) V532I probably benign Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Ano7 G A 1: 93,325,085 (GRCm39) V546M possibly damaging Het
Aox1 G A 1: 58,349,254 (GRCm39) probably null Het
Asah1 G T 8: 41,813,314 (GRCm39) S33* probably null Het
Astn1 C T 1: 158,484,763 (GRCm39) S15F possibly damaging Het
Bag4 A T 8: 26,261,272 (GRCm39) Y156* probably null Het
Bmpr1b T C 3: 141,550,948 (GRCm39) E381G probably damaging Het
Btnl7-ps A G 17: 34,756,092 (GRCm39) noncoding transcript Het
Caap1 A T 4: 94,409,297 (GRCm39) probably null Het
Card10 C T 15: 78,686,580 (GRCm39) probably null Het
Ccp110 T C 7: 118,321,614 (GRCm39) V423A possibly damaging Het
Cdc123 A G 2: 5,809,748 (GRCm39) L221P possibly damaging Het
Cdh19 A G 1: 110,882,354 (GRCm39) V46A possibly damaging Het
Cfap57 A G 4: 118,477,568 (GRCm39) F12S probably damaging Het
Clvs1 A G 4: 9,350,857 (GRCm39) probably benign Het
Dgkh A T 14: 78,856,077 (GRCm39) V199E probably damaging Het
Dhx32 T A 7: 133,340,384 (GRCm39) probably benign Het
Dpf3 G T 12: 83,417,385 (GRCm39) S29* probably null Het
Efcab7 C A 4: 99,719,780 (GRCm39) S87R probably damaging Het
Fam81a G A 9: 70,000,872 (GRCm39) Q291* probably null Het
Fbxo41 G T 6: 85,454,906 (GRCm39) N667K probably damaging Het
Flacc1 T C 1: 58,698,441 (GRCm39) T326A probably benign Het
Gm10313 A T 8: 46,708,462 (GRCm39) noncoding transcript Het
Gm28051 G A 12: 102,686,430 (GRCm39) Q77* probably null Het
Gm5535 T A 2: 144,016,569 (GRCm39) noncoding transcript Het
Gtf2ird1 A T 5: 134,431,038 (GRCm39) D339E probably damaging Het
Gvin3 A T 7: 106,199,864 (GRCm39) noncoding transcript Het
Igfbp7 A G 5: 77,555,608 (GRCm39) M85T possibly damaging Het
Il24 T C 1: 130,811,179 (GRCm39) probably null Het
Itch T C 2: 155,027,513 (GRCm39) F379L possibly damaging Het
Itgad T A 7: 127,789,015 (GRCm39) V488D possibly damaging Het
Itpr2 A T 6: 146,135,489 (GRCm39) M1814K possibly damaging Het
Kirrel3 A G 9: 34,855,735 (GRCm39) E92G possibly damaging Het
Lpin2 T C 17: 71,538,329 (GRCm39) V325A probably damaging Het
Lrba C T 3: 86,132,678 (GRCm39) T28M probably benign Het
Lrch3 T C 16: 32,818,883 (GRCm39) Y661H probably damaging Het
Lrfn5 C A 12: 61,886,461 (GRCm39) S83Y probably damaging Het
Lrp1 A C 10: 127,375,389 (GRCm39) L4435R probably benign Het
Lrrn1 A G 6: 107,546,305 (GRCm39) D701G probably benign Het
Map4k3 A T 17: 80,961,332 (GRCm39) Y125N probably benign Het
Mau2 A T 8: 70,480,353 (GRCm39) H273Q possibly damaging Het
Med16 A C 10: 79,742,871 (GRCm39) probably null Het
Mmp17 A G 5: 129,679,229 (GRCm39) H376R possibly damaging Het
Nlrp12 G A 7: 3,289,613 (GRCm39) H300Y possibly damaging Het
Nlrp3 A T 11: 59,439,554 (GRCm39) Y377F probably damaging Het
Notch2 T C 3: 98,008,952 (GRCm39) probably null Het
Nudcd1 A T 15: 44,240,039 (GRCm39) C500* probably null Het
Or52z14 T C 7: 103,253,197 (GRCm39) I112T probably damaging Het
Or5d37 A G 2: 87,923,353 (GRCm39) V309A probably damaging Het
Or6b6 T A 7: 106,570,778 (GRCm39) M258L probably benign Het
Or8g23 A T 9: 38,971,827 (GRCm39) M45K probably benign Het
Or8h9 A T 2: 86,789,698 (GRCm39) Y35N probably damaging Het
Pcdhb20 T A 18: 37,639,824 (GRCm39) N783K probably benign Het
Pclo T A 5: 14,727,896 (GRCm39) probably benign Het
Pdyn T A 2: 129,530,021 (GRCm39) D216V probably damaging Het
Phldb3 A T 7: 24,324,110 (GRCm39) I495F possibly damaging Het
Pmpca A T 2: 26,285,178 (GRCm39) I468F probably damaging Het
Pmpcb G A 5: 21,961,441 (GRCm39) R399H probably damaging Het
Polrmt G T 10: 79,572,421 (GRCm39) H1145N probably damaging Het
Proser1 A G 3: 53,371,727 (GRCm39) D11G probably damaging Het
Ptprc A G 1: 138,022,037 (GRCm39) S544P probably damaging Het
Ptprn2 G A 12: 117,240,215 (GRCm39) E991K probably damaging Het
Pwp2 A C 10: 78,009,527 (GRCm39) L797R possibly damaging Het
Rbm20 G A 19: 53,840,100 (GRCm39) A1030T probably damaging Het
Rdh7 T C 10: 127,721,691 (GRCm39) Y195C probably benign Het
Rev3l T A 10: 39,699,326 (GRCm39) D1274E probably benign Het
Scfd2 G T 5: 74,366,982 (GRCm39) H639Q probably benign Het
Sell T A 1: 163,892,887 (GRCm39) H34Q possibly damaging Het
Senp8 A C 9: 59,644,504 (GRCm39) D204E probably benign Het
Setd2 A G 9: 110,377,226 (GRCm39) D347G probably benign Het
Sh2b1 T A 7: 126,067,975 (GRCm39) R560W probably damaging Het
Slc36a3 T A 11: 55,039,399 (GRCm39) K76N probably damaging Het
Slc6a9 A T 4: 117,713,205 (GRCm39) Y60F probably damaging Het
Slfn10-ps C T 11: 82,921,207 (GRCm39) noncoding transcript Het
Spata31d1d G A 13: 59,875,334 (GRCm39) H734Y probably benign Het
Spmip10 G T 18: 56,725,494 (GRCm39) M46I possibly damaging Het
Spsb1 T A 4: 149,991,612 (GRCm39) probably benign Het
Sptbn5 T A 2: 119,882,258 (GRCm39) noncoding transcript Het
Sugp2 G A 8: 70,712,462 (GRCm39) V1026I possibly damaging Het
Syt14 T A 1: 192,613,285 (GRCm39) probably benign Het
Sytl1 G A 4: 132,982,893 (GRCm39) Q373* probably null Het
Trim38 T A 13: 23,975,312 (GRCm39) L417Q probably damaging Het
Ttll1 T C 15: 83,380,597 (GRCm39) H256R probably damaging Het
Ttyh2 A T 11: 114,587,583 (GRCm39) T195S probably benign Het
Unc119b A G 5: 115,263,553 (GRCm39) L217P probably damaging Het
Usp6nl A G 2: 6,425,714 (GRCm39) K152E probably benign Het
Vcam1 T C 3: 115,910,941 (GRCm39) R486G probably benign Het
Vmn1r225 G A 17: 20,722,831 (GRCm39) G91S possibly damaging Het
Vmn2r1 A C 3: 63,997,544 (GRCm39) Q400P possibly damaging Het
Vmn2r87 A T 10: 130,314,422 (GRCm39) L388Q probably damaging Het
Wnk1 A T 6: 119,942,696 (GRCm39) probably benign Het
Zfp239 A G 6: 117,847,478 (GRCm39) probably benign Het
Zfp688 T C 7: 127,018,327 (GRCm39) Y266C probably damaging Het
Zfp850 A T 7: 27,689,658 (GRCm39) C183* probably null Het
Zscan29 T C 2: 120,999,676 (GRCm39) probably null Het
Other mutations in Il20ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01929:Il20ra APN 10 19,635,019 (GRCm39) missense probably benign 0.01
IGL01936:Il20ra APN 10 19,631,591 (GRCm39) missense probably damaging 1.00
IGL01958:Il20ra APN 10 19,634,791 (GRCm39) missense probably benign 0.39
IGL02109:Il20ra APN 10 19,635,253 (GRCm39) missense possibly damaging 0.80
IGL02207:Il20ra APN 10 19,627,326 (GRCm39) missense probably damaging 0.99
IGL02234:Il20ra APN 10 19,625,018 (GRCm39) missense probably damaging 1.00
IGL02959:Il20ra APN 10 19,634,789 (GRCm39) missense probably benign 0.10
IGL03010:Il20ra APN 10 19,624,960 (GRCm39) missense probably damaging 1.00
P0017:Il20ra UTSW 10 19,635,154 (GRCm39) missense probably damaging 1.00
R0518:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R0521:Il20ra UTSW 10 19,635,388 (GRCm39) missense probably damaging 1.00
R1436:Il20ra UTSW 10 19,625,000 (GRCm39) missense probably damaging 1.00
R1714:Il20ra UTSW 10 19,631,576 (GRCm39) missense probably damaging 0.98
R1792:Il20ra UTSW 10 19,635,384 (GRCm39) missense probably damaging 0.99
R1852:Il20ra UTSW 10 19,618,767 (GRCm39) missense probably damaging 1.00
R2097:Il20ra UTSW 10 19,635,211 (GRCm39) missense probably damaging 1.00
R4559:Il20ra UTSW 10 19,625,032 (GRCm39) missense probably damaging 0.99
R5112:Il20ra UTSW 10 19,634,691 (GRCm39) missense possibly damaging 0.61
R5267:Il20ra UTSW 10 19,625,107 (GRCm39) missense probably damaging 0.99
R6543:Il20ra UTSW 10 19,625,071 (GRCm39) missense probably damaging 1.00
R6755:Il20ra UTSW 10 19,626,542 (GRCm39) missense probably benign 0.15
R6845:Il20ra UTSW 10 19,635,059 (GRCm39) missense probably benign 0.06
R7014:Il20ra UTSW 10 19,588,458 (GRCm39) missense unknown
R7190:Il20ra UTSW 10 19,618,689 (GRCm39) missense probably damaging 0.99
R8134:Il20ra UTSW 10 19,626,452 (GRCm39) missense probably damaging 0.99
R8955:Il20ra UTSW 10 19,635,160 (GRCm39) missense possibly damaging 0.57
R9104:Il20ra UTSW 10 19,635,364 (GRCm39) missense probably benign 0.21
R9439:Il20ra UTSW 10 19,618,751 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTCTCTACGTGCCAAAC -3'
(R):5'- TTTGCTCAGCACCACAGACAG -3'

Sequencing Primer
(F):5'- GCTTTCTCTACGTGCCAAACATAAC -3'
(R):5'- GCGTCCATCAAATGCGAAG -3'
Posted On 2016-04-27