Mutagenetix > Incidental Mutation

Incidental Mutation 'R4970:Nlrp3'

384403

Institutional Source

Beutler Lab

Gene Symbol

Nlrp3

Ensembl Gene

ENSMUSG00000032691

Gene Name

NLR family, pyrin domain containing 3

Synonyms

Cias1, cryopyrin, Pypaf1, NALP3, Mmig1

MMRRC Submission

042565-MU

Accession Numbers

Ncbi RefSeq: NM_145827.3; MGI:2653833

Essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R4970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

59541568-59566956 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59548728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 377 (Y377F)

Ref Sequence

ENSEMBL: ENSMUSP00000098707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]

AlphaFold

Q8R4B8

Predicted Effect

probably damaging
Transcript: ENSMUST00000079476
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: Y377F

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000101148
AA Change: Y377F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: Y377F

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
FISNA	135	206	1.45e-22	SMART
Pfam:NACHT	216	385	6.7e-52	PFAM
low complexity region	533	539	N/A	INTRINSIC
low complexity region	688	697	N/A	INTRINSIC
LRR_RI	737	764	1.07e-9	SMART
LRR	766	793	5.13e1	SMART
LRR	794	821	3.86e-7	SMART
LRR	823	850	1.62e0	SMART
LRR	851	878	3.39e-3	SMART
LRR	880	907	1.2e2	SMART
LRR	908	935	2.24e-3	SMART
LRR	937	964	2.16e2	SMART
LRR	965	992	8.73e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149126

SMART Domains

Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

Domain	Start	End	E-Value	Type
PYRIN	4	87	6.39e-33	SMART
Pfam:FISNA	135	173	1.6e-12	PFAM

Meta Mutation Damage Score

0.9181

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (114/115)

MGI Phenotype

Strain: 3686871
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,222,065		noncoding transcript	Het
Aars	A	G	8: 111,043,679	M370V	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acad9	A	T	3: 36,085,525	I425F	probably damaging	Het
Adhfe1	C	A	1: 9,558,238	D278E	possibly damaging	Het
Afg3l1	G	A	8: 123,498,653	V532I	probably benign	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Asah1	G	T	8: 41,360,277	S33*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Bag4	A	T	8: 25,771,244	Y156*	probably null	Het
Bmpr1b	T	C	3: 141,845,187	E381G	probably damaging	Het
Btnl7-ps	A	G	17: 34,537,118		noncoding transcript	Het
Caap1	A	T	4: 94,521,060		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Ccp110	T	C	7: 118,722,391	V423A	possibly damaging	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Cfap57	A	G	4: 118,620,371	F12S	probably damaging	Het
Clvs1	A	G	4: 9,350,857		probably benign	Het
Dgkh	A	T	14: 78,618,637	V199E	probably damaging	Het
Dhx32	T	A	7: 133,738,655		probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Efcab7	C	A	4: 99,831,543	S87R	probably damaging	Het
Fam81a	G	A	9: 70,093,590	Q291*	probably null	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gm10313	A	T	8: 46,255,425		noncoding transcript	Het
Gm1966	A	T	7: 106,600,657		noncoding transcript	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm5535	T	A	2: 144,174,649		noncoding transcript	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Igfbp7	A	G	5: 77,407,761	M85T	possibly damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Itch	T	C	2: 155,185,593	F379L	possibly damaging	Het
Itgad	T	A	7: 128,189,843	V488D	possibly damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Kirrel3	A	G	9: 34,944,439	E92G	possibly damaging	Het
Lpin2	T	C	17: 71,231,334	V325A	probably damaging	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Lrch3	T	C	16: 32,998,513	Y661H	probably damaging	Het
Lrfn5	C	A	12: 61,839,675	S83Y	probably damaging	Het
Lrp1	A	C	10: 127,539,520	L4435R	probably benign	Het
Lrrn1	A	G	6: 107,569,344	D701G	probably benign	Het
Map4k3	A	T	17: 80,653,903	Y125N	probably benign	Het
Mau2	A	T	8: 70,027,703	H273Q	possibly damaging	Het
Med16	A	C	10: 79,907,037		probably null	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr619	T	C	7: 103,603,990	I112T	probably damaging	Het
Olfr711	T	A	7: 106,971,571	M258L	probably benign	Het
Olfr937	A	T	9: 39,060,531	M45K	probably benign	Het
Pcdhb20	T	A	18: 37,506,771	N783K	probably benign	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Pdyn	T	A	2: 129,688,101	D216V	probably damaging	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Polrmt	G	T	10: 79,736,587	H1145N	probably damaging	Het
Proser1	A	G	3: 53,464,306	D11G	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Ptprn2	G	A	12: 117,276,595	E991K	probably damaging	Het
Pwp2	A	C	10: 78,173,693	L797R	possibly damaging	Het
Rbm20	G	A	19: 53,851,669	A1030T	probably damaging	Het
Rdh7	T	C	10: 127,885,822	Y195C	probably benign	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Senp8	A	C	9: 59,737,221	D204E	probably benign	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sh2b1	T	A	7: 126,468,803	R560W	probably damaging	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a9	A	T	4: 117,856,008	Y60F	probably damaging	Het
Slfn10-ps	C	T	11: 83,030,381		noncoding transcript	Het
Spata31d1d	G	A	13: 59,727,520	H734Y	probably benign	Het
Spsb1	T	A	4: 149,907,155		probably benign	Het
Sptbn5	T	A	2: 120,051,777		noncoding transcript	Het
Sugp2	G	A	8: 70,259,812	V1026I	possibly damaging	Het
Syt14	T	A	1: 192,930,977		probably benign	Het
Sytl1	G	A	4: 133,255,582	Q373*	probably null	Het
Tex43	G	T	18: 56,592,422	M46I	possibly damaging	Het
Trim38	T	A	13: 23,791,329	L417Q	probably damaging	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn1r225	G	A	17: 20,502,569	G91S	possibly damaging	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Wnk1	A	T	6: 119,965,735		probably benign	Het
Zfp239	A	G	6: 117,870,517		probably benign	Het
Zfp688	T	C	7: 127,419,155	Y266C	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het
Zscan29	T	C	2: 121,169,195		probably null	Het

Other mutations in Nlrp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Nlrp3	APN	11	59565943	missense	probably damaging	0.99
IGL00573:Nlrp3	APN	11	59565116	missense	possibly damaging	0.93
IGL01025:Nlrp3	APN	11	59551887	missense	probably benign	0.21
IGL01637:Nlrp3	APN	11	59549378	missense	probably damaging	0.99
IGL02010:Nlrp3	APN	11	59549535	missense	probably benign
IGL02334:Nlrp3	APN	11	59565083	missense	probably benign
IGL02417:Nlrp3	APN	11	59566023	unclassified	probably benign
IGL02578:Nlrp3	APN	11	59548401	missense	probably damaging	1.00
IGL02710:Nlrp3	APN	11	59565976	missense	probably damaging	0.99
IGL02816:Nlrp3	APN	11	59555782	missense	probably benign	0.03
IGL03157:Nlrp3	APN	11	59549546	missense	possibly damaging	0.80
IGL03334:Nlrp3	APN	11	59549016	missense	probably damaging	1.00
Flogiston	UTSW	11	59558448	missense	probably benign	0.00
nd1	UTSW	11	59565974	missense	probably benign	0.45
Nd14	UTSW	11	59555875	missense	possibly damaging	0.89
Nd3	UTSW	11	59565974	missense	probably benign	0.45
nd5	UTSW	11	59565879	missense	probably benign	0.01
nd6	UTSW	11	59549354	missense	probably damaging	1.00
nd7	UTSW	11	59555875	missense	possibly damaging	0.89
Nd9	UTSW	11	59549354	missense	probably damaging	1.00
Park2	UTSW	11	59565128	nonsense	probably null
Park3	UTSW	11	59565850	missense	probably benign	0.02
Park4	UTSW	11	59549531	missense	probably benign	0.19
Park5	UTSW	11	59548476	missense	probably damaging	0.99
Park6	UTSW	11	59549036	missense	probably damaging	1.00
Park7	UTSW	11	59548010	nonsense	probably null
Park8	UTSW	11	59566199	missense	probably benign	0.19
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0008:Nlrp3	UTSW	11	59558448	missense	probably benign	0.00
R0052:Nlrp3	UTSW	11	59565128	nonsense	probably null
R0362:Nlrp3	UTSW	11	59548797	missense	possibly damaging	0.49
R0416:Nlrp3	UTSW	11	59555924	splice site	probably benign
R0649:Nlrp3	UTSW	11	59548542	missense	possibly damaging	0.83
R0740:Nlrp3	UTSW	11	59548256	missense	probably benign	0.01
R0863:Nlrp3	UTSW	11	59565850	missense	probably benign	0.02
R1300:Nlrp3	UTSW	11	59555768	missense	possibly damaging	0.86
R1414:Nlrp3	UTSW	11	59549531	missense	probably benign	0.19
R1622:Nlrp3	UTSW	11	59548476	missense	probably damaging	0.99
R1654:Nlrp3	UTSW	11	59543123	missense	probably benign	0.03
R1715:Nlrp3	UTSW	11	59543351	missense	probably damaging	1.00
R1754:Nlrp3	UTSW	11	59558402	missense	possibly damaging	0.80
R1837:Nlrp3	UTSW	11	59548916	missense	probably benign	0.00
R1905:Nlrp3	UTSW	11	59549036	missense	probably damaging	1.00
R2281:Nlrp3	UTSW	11	59549136	missense	possibly damaging	0.70
R4296:Nlrp3	UTSW	11	59549661	missense	possibly damaging	0.89
R4305:Nlrp3	UTSW	11	59548010	nonsense	probably null
R4540:Nlrp3	UTSW	11	59551899	missense	possibly damaging	0.83
R4591:Nlrp3	UTSW	11	59549222	missense	probably benign	0.00
R4816:Nlrp3	UTSW	11	59548301	missense	probably benign	0.32
R4913:Nlrp3	UTSW	11	59549238	missense	probably benign	0.09
R5051:Nlrp3	UTSW	11	59566199	missense	probably benign	0.19
R5112:Nlrp3	UTSW	11	59548728	missense	probably damaging	1.00
R5185:Nlrp3	UTSW	11	59565084	missense	probably benign	0.05
R5417:Nlrp3	UTSW	11	59549063	missense	probably damaging	1.00
R5709:Nlrp3	UTSW	11	59555748	nonsense	probably null
R5869:Nlrp3	UTSW	11	59548134	missense	probably damaging	1.00
R5898:Nlrp3	UTSW	11	59546852	missense	probably benign	0.00
R5953:Nlrp3	UTSW	11	59546791	missense	probably benign
R5979:Nlrp3	UTSW	11	59548971	missense	probably benign	0.06
R6359:Nlrp3	UTSW	11	59548566	missense	probably damaging	0.97
R6723:Nlrp3	UTSW	11	59565192	missense	probably damaging	1.00
R7261:Nlrp3	UTSW	11	59548446	missense	possibly damaging	0.83
R7349:Nlrp3	UTSW	11	59548086	missense	probably damaging	1.00
R7388:Nlrp3	UTSW	11	59565066	missense	probably benign	0.00
R7715:Nlrp3	UTSW	11	59543003	splice site	probably null
R7916:Nlrp3	UTSW	11	59551863	missense	probably benign	0.00
R8222:Nlrp3	UTSW	11	59548788	missense	probably damaging	0.98
R8360:Nlrp3	UTSW	11	59549403	missense	probably benign	0.02
R8390:Nlrp3	UTSW	11	59551790	missense	possibly damaging	0.47
R8550:Nlrp3	UTSW	11	59549271	missense	probably damaging	1.00
R8738:Nlrp3	UTSW	11	59549390	missense	probably benign	0.00
R8940:Nlrp3	UTSW	11	59565044	missense	probably benign	0.26
R8990:Nlrp3	UTSW	11	59548758	missense	probably damaging	0.99
R9324:Nlrp3	UTSW	11	59543315	missense	probably damaging	1.00
R9673:Nlrp3	UTSW	11	59549322	missense	probably damaging	1.00
RF031:Nlrp3	UTSW	11	59558552	frame shift	probably null
RF040:Nlrp3	UTSW	11	59558552	frame shift	probably null
Z1088:Nlrp3	UTSW	11	59551860	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- CAGACTGGCAAAAGGCTGTG -3'
(R):5'- AGAGATGCTCCTCAATGCCC -3'

Sequencing Primer
(F):5'- TGCGGGGAGACATTCTGCTAAG -3'
(R):5'- ACGTAGACGGCCGTAGTG -3'

Posted On

2016-04-27