Mutagenetix > Incidental Mutation

Incidental Mutation 'R4970:Ptprn2'

384409

Institutional Source

Beutler Lab

Gene Symbol

Ptprn2

Ensembl Gene

ENSMUSG00000056553

Gene Name

protein tyrosine phosphatase, receptor type, N polypeptide 2

Synonyms

phogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta

MMRRC Submission

042565-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.270) question?

Stock #

R4970 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

116485720-117276849 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 117276595 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 991 (E991K)

Ref Sequence

ENSEMBL: ENSMUSP00000064046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]

AlphaFold

P80560

Predicted Effect

probably damaging
Transcript: ENSMUST00000070733
AA Change: E991K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: E991K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	495	583	1.5e-35	PFAM
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	993	4.42e-119	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186454

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190132

Predicted Effect

probably benign
Transcript: ENSMUST00000190247

SMART Domains

Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
RESP18	58	157	1.9e-40	SMART
low complexity region	393	426	N/A	INTRINSIC
Pfam:Receptor_IA-2	494	584	2.5e-43	PFAM
transmembrane domain	602	624	N/A	INTRINSIC
low complexity region	687	707	N/A	INTRINSIC
PTPc	730	932	8.81e-64	SMART

Meta Mutation Damage Score

0.2335

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (114/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700128F08Rik	A	G	9: 8,222,065		noncoding transcript	Het
Aars	A	G	8: 111,043,679	M370V	probably benign	Het
Abca2	A	G	2: 25,438,371	K846R	probably damaging	Het
Acad9	A	T	3: 36,085,525	I425F	probably damaging	Het
Adhfe1	C	A	1: 9,558,238	D278E	possibly damaging	Het
Afg3l1	G	A	8: 123,498,653	V532I	probably benign	Het
Als2cr12	T	C	1: 58,659,282	T326A	probably benign	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Ano7	G	A	1: 93,397,363	V546M	possibly damaging	Het
Aox2	G	A	1: 58,310,095		probably null	Het
Asah1	G	T	8: 41,360,277	S33*	probably null	Het
Astn1	C	T	1: 158,657,193	S15F	possibly damaging	Het
Bag4	A	T	8: 25,771,244	Y156*	probably null	Het
Bmpr1b	T	C	3: 141,845,187	E381G	probably damaging	Het
Btnl7-ps	A	G	17: 34,537,118		noncoding transcript	Het
Caap1	A	T	4: 94,521,060		probably null	Het
Card10	C	T	15: 78,802,380		probably null	Het
Ccp110	T	C	7: 118,722,391	V423A	possibly damaging	Het
Cdc123	A	G	2: 5,804,937	L221P	possibly damaging	Het
Cdh19	A	G	1: 110,954,624	V46A	possibly damaging	Het
Cfap57	A	G	4: 118,620,371	F12S	probably damaging	Het
Clvs1	A	G	4: 9,350,857		probably benign	Het
Dgkh	A	T	14: 78,618,637	V199E	probably damaging	Het
Dhx32	T	A	7: 133,738,655		probably benign	Het
Dpf3	G	T	12: 83,370,611	S29*	probably null	Het
Efcab7	C	A	4: 99,831,543	S87R	probably damaging	Het
Fam81a	G	A	9: 70,093,590	Q291*	probably null	Het
Fbxo41	G	T	6: 85,477,924	N667K	probably damaging	Het
Gm10313	A	T	8: 46,255,425		noncoding transcript	Het
Gm1966	A	T	7: 106,600,657		noncoding transcript	Het
Gm28051	G	A	12: 102,720,171	Q77*	probably null	Het
Gm5535	T	A	2: 144,174,649		noncoding transcript	Het
Gtf2ird1	A	T	5: 134,402,184	D339E	probably damaging	Het
Igfbp7	A	G	5: 77,407,761	M85T	possibly damaging	Het
Il20ra	A	G	10: 19,758,943	T311A	possibly damaging	Het
Il24	T	C	1: 130,883,442		probably null	Het
Itch	T	C	2: 155,185,593	F379L	possibly damaging	Het
Itgad	T	A	7: 128,189,843	V488D	possibly damaging	Het
Itpr2	A	T	6: 146,233,991	M1814K	possibly damaging	Het
Kirrel3	A	G	9: 34,944,439	E92G	possibly damaging	Het
Lpin2	T	C	17: 71,231,334	V325A	probably damaging	Het
Lrba	C	T	3: 86,225,371	T28M	probably benign	Het
Lrch3	T	C	16: 32,998,513	Y661H	probably damaging	Het
Lrfn5	C	A	12: 61,839,675	S83Y	probably damaging	Het
Lrp1	A	C	10: 127,539,520	L4435R	probably benign	Het
Lrrn1	A	G	6: 107,569,344	D701G	probably benign	Het
Map4k3	A	T	17: 80,653,903	Y125N	probably benign	Het
Mau2	A	T	8: 70,027,703	H273Q	possibly damaging	Het
Med16	A	C	10: 79,907,037		probably null	Het
Mmp17	A	G	5: 129,602,165	H376R	possibly damaging	Het
Nlrp12	G	A	7: 3,240,983	H300Y	possibly damaging	Het
Nlrp3	A	T	11: 59,548,728	Y377F	probably damaging	Het
Notch2	T	C	3: 98,101,636		probably null	Het
Nudcd1	A	T	15: 44,376,643	C500*	probably null	Het
Olfr1099	A	T	2: 86,959,354	Y35N	probably damaging	Het
Olfr1164	A	G	2: 88,093,009	V309A	probably damaging	Het
Olfr619	T	C	7: 103,603,990	I112T	probably damaging	Het
Olfr711	T	A	7: 106,971,571	M258L	probably benign	Het
Olfr937	A	T	9: 39,060,531	M45K	probably benign	Het
Pcdhb20	T	A	18: 37,506,771	N783K	probably benign	Het
Pclo	T	A	5: 14,677,882		probably benign	Het
Pdyn	T	A	2: 129,688,101	D216V	probably damaging	Het
Phldb3	A	T	7: 24,624,685	I495F	possibly damaging	Het
Pmpca	A	T	2: 26,395,166	I468F	probably damaging	Het
Pmpcb	G	A	5: 21,756,443	R399H	probably damaging	Het
Polrmt	G	T	10: 79,736,587	H1145N	probably damaging	Het
Proser1	A	G	3: 53,464,306	D11G	probably damaging	Het
Ptprc	A	G	1: 138,094,299	S544P	probably damaging	Het
Pwp2	A	C	10: 78,173,693	L797R	possibly damaging	Het
Rbm20	G	A	19: 53,851,669	A1030T	probably damaging	Het
Rdh7	T	C	10: 127,885,822	Y195C	probably benign	Het
Rev3l	T	A	10: 39,823,330	D1274E	probably benign	Het
Scfd2	G	T	5: 74,206,321	H639Q	probably benign	Het
Sell	T	A	1: 164,065,318	H34Q	possibly damaging	Het
Senp8	A	C	9: 59,737,221	D204E	probably benign	Het
Setd2	A	G	9: 110,548,158	D347G	probably benign	Het
Sh2b1	T	A	7: 126,468,803	R560W	probably damaging	Het
Slc36a3	T	A	11: 55,148,573	K76N	probably damaging	Het
Slc6a9	A	T	4: 117,856,008	Y60F	probably damaging	Het
Slfn10-ps	C	T	11: 83,030,381		noncoding transcript	Het
Spata31d1d	G	A	13: 59,727,520	H734Y	probably benign	Het
Spsb1	T	A	4: 149,907,155		probably benign	Het
Sptbn5	T	A	2: 120,051,777		noncoding transcript	Het
Sugp2	G	A	8: 70,259,812	V1026I	possibly damaging	Het
Syt14	T	A	1: 192,930,977		probably benign	Het
Sytl1	G	A	4: 133,255,582	Q373*	probably null	Het
Tex43	G	T	18: 56,592,422	M46I	possibly damaging	Het
Trim38	T	A	13: 23,791,329	L417Q	probably damaging	Het
Ttll1	T	C	15: 83,496,396	H256R	probably damaging	Het
Ttyh2	A	T	11: 114,696,757	T195S	probably benign	Het
Unc119b	A	G	5: 115,125,494	L217P	probably damaging	Het
Usp6nl	A	G	2: 6,420,903	K152E	probably benign	Het
Vcam1	T	C	3: 116,117,292	R486G	probably benign	Het
Vmn1r225	G	A	17: 20,502,569	G91S	possibly damaging	Het
Vmn2r1	A	C	3: 64,090,123	Q400P	possibly damaging	Het
Vmn2r87	A	T	10: 130,478,553	L388Q	probably damaging	Het
Wnk1	A	T	6: 119,965,735		probably benign	Het
Zfp239	A	G	6: 117,870,517		probably benign	Het
Zfp688	T	C	7: 127,419,155	Y266C	probably damaging	Het
Zfp850	A	T	7: 27,990,233	C183*	probably null	Het
Zscan29	T	C	2: 121,169,195		probably null	Het

Other mutations in Ptprn2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01695:Ptprn2	APN	12	116841388	missense	probably benign	0.02
IGL01788:Ptprn2	APN	12	116900987	missense	probably damaging	0.98
IGL02172:Ptprn2	APN	12	116873697	splice site	probably benign
IGL02339:Ptprn2	APN	12	116722104	missense	probably damaging	1.00
IGL02706:Ptprn2	APN	12	116888898	missense	probably damaging	0.96
IGL03018:Ptprn2	APN	12	117211943	missense	probably damaging	1.00
IGL03267:Ptprn2	APN	12	116876344	nonsense	probably null
BB001:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
BB011:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
IGL03014:Ptprn2	UTSW	12	117248688	missense	probably damaging	1.00
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0066:Ptprn2	UTSW	12	117276602	missense	probably benign	0.07
R0115:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0131:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0132:Ptprn2	UTSW	12	116722091	missense	probably damaging	1.00
R0481:Ptprn2	UTSW	12	117211846	splice site	probably benign
R0694:Ptprn2	UTSW	12	116824355	missense	possibly damaging	0.69
R0698:Ptprn2	UTSW	12	116722130	nonsense	probably null
R0746:Ptprn2	UTSW	12	116901017	missense	probably benign	0.00
R1127:Ptprn2	UTSW	12	117212008	splice site	probably null
R1443:Ptprn2	UTSW	12	117253615	missense	probably damaging	1.00
R1508:Ptprn2	UTSW	12	117184722	missense	probably damaging	1.00
R1664:Ptprn2	UTSW	12	117161709	missense	probably damaging	0.99
R1670:Ptprn2	UTSW	12	116722172	missense	possibly damaging	0.64
R1749:Ptprn2	UTSW	12	116580428	missense	probably benign	0.00
R2075:Ptprn2	UTSW	12	117247717	missense	probably benign	0.01
R3054:Ptprn2	UTSW	12	116722133	missense	probably damaging	1.00
R3107:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3109:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R3552:Ptprn2	UTSW	12	116888877	missense	probably benign	0.00
R4193:Ptprn2	UTSW	12	116901008	missense	probably benign	0.01
R4523:Ptprn2	UTSW	12	116876000	missense	probably damaging	1.00
R4706:Ptprn2	UTSW	12	116872094	missense	probably benign	0.02
R4719:Ptprn2	UTSW	12	116824396	missense	possibly damaging	0.95
R4726:Ptprn2	UTSW	12	117247773	nonsense	probably null
R4872:Ptprn2	UTSW	12	117161694	missense	probably damaging	1.00
R4891:Ptprn2	UTSW	12	117233365	splice site	probably null
R5208:Ptprn2	UTSW	12	116858928	missense	probably damaging	1.00
R5287:Ptprn2	UTSW	12	117211862	missense	probably damaging	1.00
R5419:Ptprn2	UTSW	12	117184647	missense	probably damaging	0.99
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6035:Ptprn2	UTSW	12	117255595	missense	probably damaging	1.00
R6180:Ptprn2	UTSW	12	116859119	missense	probably benign	0.05
R6277:Ptprn2	UTSW	12	116876180	missense	probably benign	0.04
R6465:Ptprn2	UTSW	12	117269589	missense	probably damaging	0.96
R6488:Ptprn2	UTSW	12	116872038	missense	probably benign	0.13
R6555:Ptprn2	UTSW	12	117227200	missense	probably damaging	1.00
R6908:Ptprn2	UTSW	12	116888888	missense	probably benign	0.06
R7120:Ptprn2	UTSW	12	116872056	missense	probably benign	0.01
R7229:Ptprn2	UTSW	12	117227225	splice site	probably null
R7237:Ptprn2	UTSW	12	117161727	missense	probably benign	0.03
R7304:Ptprn2	UTSW	12	117248544	missense	probably damaging	1.00
R7355:Ptprn2	UTSW	12	116858951	missense	probably benign
R7460:Ptprn2	UTSW	12	117248681	missense	probably benign	0.05
R7577:Ptprn2	UTSW	12	116485866	start codon destroyed	probably null
R7658:Ptprn2	UTSW	12	116722119	missense	probably benign	0.01
R7666:Ptprn2	UTSW	12	116841320	missense	probably benign	0.10
R7924:Ptprn2	UTSW	12	116841264	missense	probably benign	0.00
R8219:Ptprn2	UTSW	12	117184737	missense	probably benign	0.30
R8716:Ptprn2	UTSW	12	117255548	missense	possibly damaging	0.73
R9235:Ptprn2	UTSW	12	117269651	critical splice donor site	probably null
R9605:Ptprn2	UTSW	12	117161658	missense	probably benign	0.13
X0066:Ptprn2	UTSW	12	117161760	missense	probably damaging	1.00
X0066:Ptprn2	UTSW	12	117184740	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- TCATCAGGAGCAAGGCTTTC -3'
(R):5'- GTACACATGACTAGCCACCTGC -3'

Sequencing Primer
(F):5'- GAGCAAGGCTTTCCCCCAC -3'
(R):5'- TAGCCACCTGCACTGACTG -3'

Posted On

2016-04-27