Incidental Mutation 'R4970:Map4k3'
ID384418
Institutional Source Beutler Lab
Gene Symbol Map4k3
Ensembl Gene ENSMUSG00000024242
Gene Namemitogen-activated protein kinase kinase kinase kinase 3
Synonyms
MMRRC Submission 042565-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4970 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location80580512-80728093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80653903 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 125 (Y125N)
Ref Sequence ENSEMBL: ENSMUSP00000025089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025089] [ENSMUST00000112389]
Predicted Effect probably benign
Transcript: ENSMUST00000025089
AA Change: Y125N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025089
Gene: ENSMUSG00000024242
AA Change: Y125N

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 874 2e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112389
AA Change: Y125N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108008
Gene: ENSMUSG00000024242
AA Change: Y125N

DomainStartEndE-ValueType
S_TKc 16 273 9.71e-95 SMART
low complexity region 299 304 N/A INTRINSIC
low complexity region 413 421 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 467 491 N/A INTRINSIC
CNH 561 876 1.39e-114 SMART
Meta Mutation Damage Score 0.1312 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (114/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase kinase kinase kinase family. The encoded protein activates key effectors in cell signalling, among them c-Jun. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased susceptibility to experimental autoimmune encephalomyelitis, decreased stimulated immunoglobin production, decreased stimulated T cell proliferation, and abnormal Th1, Th2, and Th17 differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700128F08Rik A G 9: 8,222,065 noncoding transcript Het
Aars A G 8: 111,043,679 M370V probably benign Het
Abca2 A G 2: 25,438,371 K846R probably damaging Het
Acad9 A T 3: 36,085,525 I425F probably damaging Het
Adhfe1 C A 1: 9,558,238 D278E possibly damaging Het
Afg3l1 G A 8: 123,498,653 V532I probably benign Het
Als2cr12 T C 1: 58,659,282 T326A probably benign Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Ano7 G A 1: 93,397,363 V546M possibly damaging Het
Aox2 G A 1: 58,310,095 probably null Het
Asah1 G T 8: 41,360,277 S33* probably null Het
Astn1 C T 1: 158,657,193 S15F possibly damaging Het
Bag4 A T 8: 25,771,244 Y156* probably null Het
Bmpr1b T C 3: 141,845,187 E381G probably damaging Het
Btnl7-ps A G 17: 34,537,118 noncoding transcript Het
Caap1 A T 4: 94,521,060 probably null Het
Card10 C T 15: 78,802,380 probably null Het
Ccp110 T C 7: 118,722,391 V423A possibly damaging Het
Cdc123 A G 2: 5,804,937 L221P possibly damaging Het
Cdh19 A G 1: 110,954,624 V46A possibly damaging Het
Cfap57 A G 4: 118,620,371 F12S probably damaging Het
Clvs1 A G 4: 9,350,857 probably benign Het
Dgkh A T 14: 78,618,637 V199E probably damaging Het
Dhx32 T A 7: 133,738,655 probably benign Het
Dpf3 G T 12: 83,370,611 S29* probably null Het
Efcab7 C A 4: 99,831,543 S87R probably damaging Het
Fam81a G A 9: 70,093,590 Q291* probably null Het
Fbxo41 G T 6: 85,477,924 N667K probably damaging Het
Gm10313 A T 8: 46,255,425 noncoding transcript Het
Gm1966 A T 7: 106,600,657 noncoding transcript Het
Gm28051 G A 12: 102,720,171 Q77* probably null Het
Gm5535 T A 2: 144,174,649 noncoding transcript Het
Gtf2ird1 A T 5: 134,402,184 D339E probably damaging Het
Igfbp7 A G 5: 77,407,761 M85T possibly damaging Het
Il20ra A G 10: 19,758,943 T311A possibly damaging Het
Il24 T C 1: 130,883,442 probably null Het
Itch T C 2: 155,185,593 F379L possibly damaging Het
Itgad T A 7: 128,189,843 V488D possibly damaging Het
Itpr2 A T 6: 146,233,991 M1814K possibly damaging Het
Kirrel3 A G 9: 34,944,439 E92G possibly damaging Het
Lpin2 T C 17: 71,231,334 V325A probably damaging Het
Lrba C T 3: 86,225,371 T28M probably benign Het
Lrch3 T C 16: 32,998,513 Y661H probably damaging Het
Lrfn5 C A 12: 61,839,675 S83Y probably damaging Het
Lrp1 A C 10: 127,539,520 L4435R probably benign Het
Lrrn1 A G 6: 107,569,344 D701G probably benign Het
Mau2 A T 8: 70,027,703 H273Q possibly damaging Het
Med16 A C 10: 79,907,037 probably null Het
Mmp17 A G 5: 129,602,165 H376R possibly damaging Het
Nlrp12 G A 7: 3,240,983 H300Y possibly damaging Het
Nlrp3 A T 11: 59,548,728 Y377F probably damaging Het
Notch2 T C 3: 98,101,636 probably null Het
Nudcd1 A T 15: 44,376,643 C500* probably null Het
Olfr1099 A T 2: 86,959,354 Y35N probably damaging Het
Olfr1164 A G 2: 88,093,009 V309A probably damaging Het
Olfr619 T C 7: 103,603,990 I112T probably damaging Het
Olfr711 T A 7: 106,971,571 M258L probably benign Het
Olfr937 A T 9: 39,060,531 M45K probably benign Het
Pcdhb20 T A 18: 37,506,771 N783K probably benign Het
Pclo T A 5: 14,677,882 probably benign Het
Pdyn T A 2: 129,688,101 D216V probably damaging Het
Phldb3 A T 7: 24,624,685 I495F possibly damaging Het
Pmpca A T 2: 26,395,166 I468F probably damaging Het
Pmpcb G A 5: 21,756,443 R399H probably damaging Het
Polrmt G T 10: 79,736,587 H1145N probably damaging Het
Proser1 A G 3: 53,464,306 D11G probably damaging Het
Ptprc A G 1: 138,094,299 S544P probably damaging Het
Ptprn2 G A 12: 117,276,595 E991K probably damaging Het
Pwp2 A C 10: 78,173,693 L797R possibly damaging Het
Rbm20 G A 19: 53,851,669 A1030T probably damaging Het
Rdh7 T C 10: 127,885,822 Y195C probably benign Het
Rev3l T A 10: 39,823,330 D1274E probably benign Het
Scfd2 G T 5: 74,206,321 H639Q probably benign Het
Sell T A 1: 164,065,318 H34Q possibly damaging Het
Senp8 A C 9: 59,737,221 D204E probably benign Het
Setd2 A G 9: 110,548,158 D347G probably benign Het
Sh2b1 T A 7: 126,468,803 R560W probably damaging Het
Slc36a3 T A 11: 55,148,573 K76N probably damaging Het
Slc6a9 A T 4: 117,856,008 Y60F probably damaging Het
Slfn10-ps C T 11: 83,030,381 noncoding transcript Het
Spata31d1d G A 13: 59,727,520 H734Y probably benign Het
Spsb1 T A 4: 149,907,155 probably benign Het
Sptbn5 T A 2: 120,051,777 noncoding transcript Het
Sugp2 G A 8: 70,259,812 V1026I possibly damaging Het
Syt14 T A 1: 192,930,977 probably benign Het
Sytl1 G A 4: 133,255,582 Q373* probably null Het
Tex43 G T 18: 56,592,422 M46I possibly damaging Het
Trim38 T A 13: 23,791,329 L417Q probably damaging Het
Ttll1 T C 15: 83,496,396 H256R probably damaging Het
Ttyh2 A T 11: 114,696,757 T195S probably benign Het
Unc119b A G 5: 115,125,494 L217P probably damaging Het
Usp6nl A G 2: 6,420,903 K152E probably benign Het
Vcam1 T C 3: 116,117,292 R486G probably benign Het
Vmn1r225 G A 17: 20,502,569 G91S possibly damaging Het
Vmn2r1 A C 3: 64,090,123 Q400P possibly damaging Het
Vmn2r87 A T 10: 130,478,553 L388Q probably damaging Het
Wnk1 A T 6: 119,965,735 probably benign Het
Zfp239 A G 6: 117,870,517 probably benign Het
Zfp688 T C 7: 127,419,155 Y266C probably damaging Het
Zfp850 A T 7: 27,990,233 C183* probably null Het
Zscan29 T C 2: 121,169,195 probably null Het
Other mutations in Map4k3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Map4k3 APN 17 80636718 critical splice donor site probably null
IGL01329:Map4k3 APN 17 80644184 missense probably benign
IGL01626:Map4k3 APN 17 80605809 missense probably damaging 0.97
IGL01896:Map4k3 APN 17 80613931 missense probably benign 0.13
IGL02021:Map4k3 APN 17 80609826 missense probably damaging 1.00
IGL02585:Map4k3 APN 17 80653919 splice site probably benign
IGL03101:Map4k3 APN 17 80655855 critical splice donor site probably null
IGL03231:Map4k3 APN 17 80597675 missense probably damaging 1.00
IGL03267:Map4k3 APN 17 80664028 missense probably damaging 1.00
maple_forest UTSW 17 80603998 missense probably benign 0.38
R0084:Map4k3 UTSW 17 80655914 missense possibly damaging 0.91
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0211:Map4k3 UTSW 17 80644841 missense probably damaging 1.00
R0612:Map4k3 UTSW 17 80602193 missense probably damaging 1.00
R0842:Map4k3 UTSW 17 80605983 missense probably benign 0.35
R2009:Map4k3 UTSW 17 80664088 splice site probably benign
R2224:Map4k3 UTSW 17 80630454 missense probably benign 0.00
R3851:Map4k3 UTSW 17 80644323 splice site probably benign
R4049:Map4k3 UTSW 17 80605965 missense probably benign 0.10
R4151:Map4k3 UTSW 17 80644534 missense probably damaging 1.00
R4345:Map4k3 UTSW 17 80597551 critical splice donor site probably null
R4405:Map4k3 UTSW 17 80615015 critical splice donor site probably null
R4450:Map4k3 UTSW 17 80603982 critical splice donor site probably null
R5230:Map4k3 UTSW 17 80615170 missense probably benign 0.00
R5459:Map4k3 UTSW 17 80609787 missense probably damaging 1.00
R5568:Map4k3 UTSW 17 80663998 missense possibly damaging 0.96
R5635:Map4k3 UTSW 17 80613495 missense possibly damaging 0.94
R5827:Map4k3 UTSW 17 80593283 critical splice donor site probably null
R5927:Map4k3 UTSW 17 80613919 missense probably benign 0.06
R5951:Map4k3 UTSW 17 80603998 missense probably benign 0.38
R5964:Map4k3 UTSW 17 80644762 missense probably damaging 1.00
R6849:Map4k3 UTSW 17 80630413 critical splice donor site probably null
R6985:Map4k3 UTSW 17 80636732 missense probably damaging 1.00
R7040:Map4k3 UTSW 17 80680915 missense probably damaging 0.98
R7233:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7511:Map4k3 UTSW 17 80597648 missense possibly damaging 0.80
R7672:Map4k3 UTSW 17 80615071 missense possibly damaging 0.58
R7680:Map4k3 UTSW 17 80581876 missense probably benign 0.02
R7804:Map4k3 UTSW 17 80615070 missense probably damaging 0.98
X0023:Map4k3 UTSW 17 80593091 missense probably benign
Z1176:Map4k3 UTSW 17 80618337 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TAGTGTATGTGACCCTGACTCAAC -3'
(R):5'- TAGCCTAGAATTCAAGCACTATGGG -3'

Sequencing Primer
(F):5'- GTATGTGACCCTGACTCAACAATGC -3'
(R):5'- CAAGCACTATGGGTCTGTATAGTCC -3'
Posted On2016-04-27