Incidental Mutation 'R4971:Slc13a3'
ID384429
Institutional Source Beutler Lab
Gene Symbol Slc13a3
Ensembl Gene ENSMUSG00000018459
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
SynonymsSDCT2, NaDC-3, NaDC3
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4971 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165405028-165473230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165448699 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 67 (I67T)
Ref Sequence ENSEMBL: ENSMUSP00000104902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029208
AA Change: I67T

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: I67T

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 571 2.6e-110 PFAM
Pfam:CitMHS 43 167 1.4e-15 PFAM
Pfam:CitMHS 221 486 5.3e-18 PFAM
low complexity region 578 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109279
AA Change: I67T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459
AA Change: I67T

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 270 6.7e-49 PFAM
Pfam:Na_sulph_symp 265 529 1.9e-51 PFAM
low complexity region 536 554 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152284
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Cnot1 A G 8: 95,721,626 F2266S probably damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Pdlim2 A G 14: 70,167,759 V219A probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Rhot1 T A 11: 80,233,474 I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Tbc1d2b A T 9: 90,218,870 M689K probably benign Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zfp456 T C 13: 67,366,876 E237G probably benign Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Slc13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc13a3 APN 2 165411923 missense probably damaging 1.00
IGL00326:Slc13a3 APN 2 165473097 missense possibly damaging 0.89
IGL01308:Slc13a3 APN 2 165406780 missense probably damaging 0.99
IGL01668:Slc13a3 APN 2 165430292 missense probably damaging 1.00
IGL02435:Slc13a3 APN 2 165408940 missense possibly damaging 0.95
IGL02551:Slc13a3 APN 2 165424573 missense probably damaging 1.00
IGL02716:Slc13a3 APN 2 165406715 missense unknown
IGL03107:Slc13a3 APN 2 165437307 missense probably benign 0.00
R0114:Slc13a3 UTSW 2 165424581 missense probably damaging 1.00
R0624:Slc13a3 UTSW 2 165411887 missense probably damaging 1.00
R1051:Slc13a3 UTSW 2 165408820 critical splice donor site probably null
R1780:Slc13a3 UTSW 2 165406699 missense unknown
R1782:Slc13a3 UTSW 2 165445519 missense probably benign 0.01
R1994:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R4739:Slc13a3 UTSW 2 165430289 missense possibly damaging 0.91
R5091:Slc13a3 UTSW 2 165420080 missense probably benign 0.11
R5093:Slc13a3 UTSW 2 165411896 missense probably damaging 1.00
R5826:Slc13a3 UTSW 2 165408956 missense probably benign 0.05
R5894:Slc13a3 UTSW 2 165424623 missense probably benign 0.00
R6239:Slc13a3 UTSW 2 165406697 missense unknown
R6394:Slc13a3 UTSW 2 165434097 missense probably damaging 1.00
R6453:Slc13a3 UTSW 2 165411947 missense possibly damaging 0.94
R6463:Slc13a3 UTSW 2 165445653 missense probably damaging 1.00
R6480:Slc13a3 UTSW 2 165408898 missense probably damaging 1.00
R6525:Slc13a3 UTSW 2 165406747 missense unknown
R6879:Slc13a3 UTSW 2 165430301 missense probably damaging 1.00
R7278:Slc13a3 UTSW 2 165445528 missense possibly damaging 0.87
R7340:Slc13a3 UTSW 2 165430290 missense probably benign 0.00
R7404:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R7452:Slc13a3 UTSW 2 165427114 missense probably benign 0.03
R7585:Slc13a3 UTSW 2 165430322 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAGAGCTTTGCCTTCCACC -3'
(R):5'- GATGATATGCCCACTGCTTCC -3'

Sequencing Primer
(F):5'- TCTCACCTTGCAGGCTGGAC -3'
(R):5'- ACTGCTTCCCTGAGCGTGAG -3'
Posted On2016-04-27