Mutagenetix > Incidental Mutations

Incidental Mutation 'R4971:Adamtsl1'

384436

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl1

Ensembl Gene

ENSMUSG00000066113

Gene Name

ADAMTS-like 1

Synonyms

5930437A14Rik, 6720426B09Rik, punctin-1

MMRRC Submission

042566-MU

Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R4971 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85514172-86428385 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86336931 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 746 (F746L)

Ref Sequence

ENSEMBL: ENSMUSP00000119278 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107178] [ENSMUST00000141889]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000107177

Predicted Effect

probably damaging
Transcript: ENSMUST00000107178
AA Change: F754L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102796
Gene: ENSMUSG00000066113
AA Change: F754L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	362	421	2.05e-2	SMART
TSP1	422	476	3.99e-4	SMART
TSP1	508	567	6.39e-3	SMART
TSP1	593	650	7.86e-3	SMART
TSP1	652	712	3.78e-5	SMART
TSP1	715	772	2.66e-2	SMART
TSP1	774	833	1.62e-4	SMART
IGc2	873	937	4.19e-6	SMART
low complexity region	1123	1142	N/A	INTRINSIC
IGc2	1175	1240	1.31e-7	SMART
IGc2	1282	1351	7.81e-15	SMART
IGc2	1400	1467	2.39e-10	SMART
TSP1	1481	1537	2.12e-1	SMART
TSP1	1540	1599	1.74e-4	SMART
TSP1	1600	1658	8.2e0	SMART
TSP1	1660	1717	1.96e-1	SMART
Pfam:PLAC	1721	1751	1.4e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141889
AA Change: F746L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119278
Gene: ENSMUSG00000066113
AA Change: F746L

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
TSP1	36	82	8.95e-7	SMART
TSP1	301	360	4.35e-2	SMART
TSP1	379	438	2.05e-2	SMART
TSP1	439	493	3.99e-4	SMART
TSP1	525	584	6.39e-3	SMART
TSP1	610	667	7.86e-3	SMART
TSP1	707	764	2.66e-2	SMART
TSP1	766	825	1.62e-4	SMART
IGc2	865	929	4.19e-6	SMART
low complexity region	1115	1134	N/A	INTRINSIC
IGc2	1167	1232	1.31e-7	SMART
IGc2	1274	1343	7.81e-15	SMART
IGc2	1392	1459	2.39e-10	SMART
TSP1	1473	1529	2.12e-1	SMART
TSP1	1532	1591	1.74e-4	SMART
TSP1	1592	1650	8.2e0	SMART
TSP1	1652	1709	1.96e-1	SMART
Pfam:PLAC	1712	1744	5.6e-12	PFAM

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.6%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	C	6: 149,325,599		probably benign	Het
A2ml1	A	T	6: 128,547,227	F1147L	probably damaging	Het
Abca2	T	C	2: 25,441,994	S1373P	probably damaging	Het
Abca9	A	T	11: 110,152,048	S392T	probably benign	Het
Abcd2	T	C	15: 91,163,110	D580G	probably benign	Het
Actl9	T	A	17: 33,433,908	L314H	probably damaging	Het
Anks6	C	T	4: 47,030,795	G601S	probably damaging	Het
Cd3eap	T	C	7: 19,357,562	N207D	probably benign	Het
Cdkl3	T	C	11: 52,011,168	V68A	possibly damaging	Het
Cnot1	A	G	8: 95,721,626	F2266S	probably damaging	Het
Colq	T	C	14: 31,545,077	R159G	probably damaging	Het
Ctse	A	T	1: 131,664,392	D152V	probably damaging	Het
Cul7	G	T	17: 46,659,119	M1011I	probably benign	Het
Cyb5r4	G	T	9: 87,057,171	V336L	possibly damaging	Het
Dync2h1	A	T	9: 7,131,949	H1619Q	probably benign	Het
Eif2ak1	A	G	5: 143,882,168	K216E	probably damaging	Het
F5	A	T	1: 164,194,186	H1410L	probably benign	Het
Frem2	T	C	3: 53,539,183	Y2388C	probably damaging	Het
Fsip2	C	T	2: 82,985,878	T3985M	probably benign	Het
Gak	T	C	5: 108,596,806	Y535C	probably damaging	Het
Gm15448	T	A	7: 3,822,806	M355L	probably benign	Het
Gzmc	G	T	14: 56,232,369	P158Q	probably damaging	Het
Hook3	A	G	8: 26,082,579	Y135H	probably benign	Het
Ikbke	GCC	G	1: 131,275,267		probably null	Het
Ing4	A	T	6: 125,043,998	M28L	probably benign	Het
Irs3	T	A	5: 137,644,492	D228V	probably damaging	Het
Jade1	T	A	3: 41,601,401	I301N	probably damaging	Het
Kif13b	T	A	14: 64,757,562	M921K	possibly damaging	Het
Kmt2c	A	G	5: 25,310,872	S2658P	probably benign	Het
Map3k4	A	G	17: 12,249,495		probably null	Het
Map4k5	C	T	12: 69,852,719	V53I	possibly damaging	Het
Mdn1	T	C	4: 32,739,827	S3694P	probably damaging	Het
Mgea5	C	A	19: 45,770,046		probably null	Het
Mroh7	A	G	4: 106,691,552	V1038A	probably benign	Het
Muc5ac	T	C	7: 141,816,278	V3185A	possibly damaging	Het
Mup5	T	A	4: 61,833,060	N117I	probably benign	Het
Myo19	T	A	11: 84,892,197	M179K	probably damaging	Het
Myo1c	A	G	11: 75,671,588	Y902C	probably damaging	Het
Nf1	T	A	11: 79,444,643	I977K	probably damaging	Het
Nos1	T	C	5: 117,943,834	V1240A	probably benign	Het
Nr3c1	T	C	18: 39,486,877	D119G	probably damaging	Het
Olfr1212	A	T	2: 88,958,519	N18Y	probably damaging	Het
Pdlim2	A	G	14: 70,167,759	V219A	probably damaging	Het
Prdx1	T	C	4: 116,691,931		probably null	Het
Rbfox1	C	T	16: 7,294,088	R173C	probably damaging	Het
Rbp3	T	A	14: 33,954,470	V125D	probably damaging	Het
Rhot1	T	A	11: 80,233,474	I154K	probably damaging	Het
Runx1t1	C	T	4: 13,837,978	R129C	probably damaging	Het
Setbp1	A	G	18: 78,858,167	S762P	probably benign	Het
Slc13a3	A	G	2: 165,448,699	I67T	probably damaging	Het
Tbc1d2b	A	T	9: 90,218,870	M689K	probably benign	Het
Top2a	T	C	11: 98,993,841	Y1517C	probably damaging	Het
Txndc2	A	T	17: 65,638,854	N109K	probably damaging	Het
Tyk2	A	G	9: 21,120,501		probably null	Het
Wdfy3	A	T	5: 101,948,972	L320*	probably null	Het
Zfp456	T	C	13: 67,366,876	E237G	probably benign	Het
Zscan10	A	G	17: 23,607,173	E103G	possibly damaging	Het

Other mutations in Adamtsl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Adamtsl1	APN	4	86385640	missense	probably benign	0.01
IGL00741:Adamtsl1	APN	4	86276948	missense	probably damaging	1.00
IGL00770:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00774:Adamtsl1	APN	4	86388539	missense	possibly damaging	0.65
IGL00826:Adamtsl1	APN	4	86156804	missense	probably damaging	1.00
IGL00938:Adamtsl1	APN	4	86342278	missense	possibly damaging	0.93
IGL01012:Adamtsl1	APN	4	86342189	missense	possibly damaging	0.93
IGL01728:Adamtsl1	APN	4	86110837	missense	probably damaging	1.00
IGL01801:Adamtsl1	APN	4	86199322	missense	probably benign	0.23
IGL01922:Adamtsl1	APN	4	86249902	missense	probably damaging	1.00
IGL02006:Adamtsl1	APN	4	86199345	missense	probably damaging	1.00
IGL02192:Adamtsl1	APN	4	86228016	missense	probably damaging	1.00
IGL02351:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02358:Adamtsl1	APN	4	86156873	critical splice donor site	probably null
IGL02373:Adamtsl1	APN	4	86249805	missense	probably damaging	1.00
IGL02660:Adamtsl1	APN	4	86232610	missense	probably damaging	1.00
IGL02964:Adamtsl1	APN	4	86424357	missense	probably damaging	1.00
IGL03233:Adamtsl1	APN	4	86342120	missense	probably damaging	1.00
IGL03297:Adamtsl1	APN	4	86423426	missense	probably damaging	0.98
IGL03326:Adamtsl1	APN	4	86252748	splice site	probably benign
PIT4378001:Adamtsl1	UTSW	4	86199364	missense	possibly damaging	0.93
PIT4418001:Adamtsl1	UTSW	4	86243724	missense	probably damaging	1.00
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0131:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0132:Adamtsl1	UTSW	4	86342723	missense	possibly damaging	0.94
R0453:Adamtsl1	UTSW	4	86232615	missense	probably damaging	1.00
R0480:Adamtsl1	UTSW	4	86252818	missense	probably benign	0.08
R0496:Adamtsl1	UTSW	4	86341198	missense	probably damaging	1.00
R0538:Adamtsl1	UTSW	4	86343121	missense	probably benign	0.27
R0547:Adamtsl1	UTSW	4	86356355	missense	probably benign	0.37
R0567:Adamtsl1	UTSW	4	86228016	missense	probably damaging	1.00
R0568:Adamtsl1	UTSW	4	86418552	missense	probably damaging	1.00
R0639:Adamtsl1	UTSW	4	86277143	missense	probably damaging	1.00
R0931:Adamtsl1	UTSW	4	86249847	missense	probably benign	0.05
R1186:Adamtsl1	UTSW	4	86388509	missense	probably benign	0.00
R1387:Adamtsl1	UTSW	4	86374993	splice site	probably benign
R1459:Adamtsl1	UTSW	4	86425865	missense	probably damaging	1.00
R1518:Adamtsl1	UTSW	4	86342603	missense	probably damaging	0.99
R1532:Adamtsl1	UTSW	4	86248065	missense	probably benign	0.02
R1603:Adamtsl1	UTSW	4	86415530	missense	probably benign
R1931:Adamtsl1	UTSW	4	86342411	missense	possibly damaging	0.62
R2086:Adamtsl1	UTSW	4	86228012	missense	probably damaging	1.00
R2221:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2223:Adamtsl1	UTSW	4	86388525	missense	probably benign	0.19
R2396:Adamtsl1	UTSW	4	86343119	nonsense	probably null
R2397:Adamtsl1	UTSW	4	86199357	missense	probably damaging	1.00
R2426:Adamtsl1	UTSW	4	86156788	missense	probably benign	0.01
R3121:Adamtsl1	UTSW	4	86337009	missense	probably damaging	1.00
R3715:Adamtsl1	UTSW	4	86216976	missense	probably benign	0.01
R3848:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3849:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R3850:Adamtsl1	UTSW	4	86418546	missense	probably damaging	1.00
R4194:Adamtsl1	UTSW	4	86054008	intron	probably benign
R4354:Adamtsl1	UTSW	4	86156684	missense	probably damaging	1.00
R4795:Adamtsl1	UTSW	4	86243769	critical splice donor site	probably null
R4830:Adamtsl1	UTSW	4	86356382	missense	probably damaging	0.97
R4874:Adamtsl1	UTSW	4	86342492	missense	possibly damaging	0.94
R4939:Adamtsl1	UTSW	4	86243725	missense	possibly damaging	0.95
R4942:Adamtsl1	UTSW	4	86341214	nonsense	probably null
R4947:Adamtsl1	UTSW	4	85764800	missense	possibly damaging	0.93
R4960:Adamtsl1	UTSW	4	86424173	nonsense	probably null
R5141:Adamtsl1	UTSW	4	86156850	missense	possibly damaging	0.77
R5213:Adamtsl1	UTSW	4	86385628	missense	possibly damaging	0.89
R5237:Adamtsl1	UTSW	4	86385669	critical splice donor site	probably null
R5250:Adamtsl1	UTSW	4	86216945	nonsense	probably null
R5411:Adamtsl1	UTSW	4	86388413	critical splice acceptor site	probably null
R5554:Adamtsl1	UTSW	4	86276945	missense	possibly damaging	0.69
R5631:Adamtsl1	UTSW	4	86276923	nonsense	probably null
R5739:Adamtsl1	UTSW	4	86232664	missense	probably damaging	1.00
R5905:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6028:Adamtsl1	UTSW	4	86342324	missense	probably damaging	1.00
R6044:Adamtsl1	UTSW	4	86212691	missense	probably damaging	1.00
R6261:Adamtsl1	UTSW	4	86336878	missense	probably benign	0.09
R6300:Adamtsl1	UTSW	4	86248017	missense	probably damaging	1.00
R6332:Adamtsl1	UTSW	4	86217011	missense	probably damaging	0.96
R6560:Adamtsl1	UTSW	4	86336893	missense	probably damaging	1.00
R6693:Adamtsl1	UTSW	4	86342886	missense	probably benign	0.27
R6736:Adamtsl1	UTSW	4	86342247	missense	probably damaging	1.00
R6964:Adamtsl1	UTSW	4	86156854	missense	probably damaging	1.00
R7064:Adamtsl1	UTSW	4	86342041	missense	possibly damaging	0.80
R7434:Adamtsl1	UTSW	4	86425878	missense	probably damaging	0.99
R7477:Adamtsl1	UTSW	4	86415651	missense	probably damaging	1.00
R7545:Adamtsl1	UTSW	4	85764855	missense	probably damaging	1.00
R7556:Adamtsl1	UTSW	4	86277121	missense	probably benign	0.19
R7580:Adamtsl1	UTSW	4	86054064	missense	possibly damaging	0.53
R7593:Adamtsl1	UTSW	4	86341213	missense	probably damaging	1.00
R7710:Adamtsl1	UTSW	4	86232573	missense

Predicted Primers

PCR Primer
(F):5'- GACCTGACTCCTGGTTTGTC -3'
(R):5'- TTCCACACTGTCAGGAGAGC -3'

Sequencing Primer
(F):5'- GACCTGACTCCTGGTTTGTCAAAAAC -3'
(R):5'- CCACACTGTCAGGAGAGCTTTTTG -3'

Posted On

2016-04-27