Incidental Mutation 'R4971:Cnot1'
ID 384451
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4971 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 95721626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 2266 (F2266S)
Ref Sequence ENSEMBL: ENSMUSP00000096073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034096] [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000141900] [ENSMUST00000148727] [ENSMUST00000211887] [ENSMUST00000213006]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034096
SMART Domains Protein: ENSMUSP00000034096
Gene: ENSMUSG00000031671

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
SET 62 293 1.84e0 SMART
Pfam:Rubis-subs-bind 330 465 1.3e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000068452
AA Change: F2261S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: F2261S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098473
AA Change: F2266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: F2266S

DomainStartEndE-ValueType
low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126888
Predicted Effect probably benign
Transcript: ENSMUST00000141900
Predicted Effect probably benign
Transcript: ENSMUST00000148727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154052
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154593
Predicted Effect probably damaging
Transcript: ENSMUST00000211887
AA Change: F2259S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212302
Predicted Effect probably benign
Transcript: ENSMUST00000213006
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Pdlim2 A G 14: 70,167,759 V219A probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Rhot1 T A 11: 80,233,474 I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Slc13a3 A G 2: 165,448,699 I67T probably damaging Het
Tbc1d2b A T 9: 90,218,870 M689K probably benign Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zfp456 T C 13: 67,366,876 E237G probably benign Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
Quorum UTSW 8 95726118 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0409:Cnot1 UTSW 8 95748855 missense probably damaging 0.96
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9179:Cnot1 UTSW 8 95773426 missense probably benign 0.16
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9480:Cnot1 UTSW 8 95770710 missense possibly damaging 0.94
R9548:Cnot1 UTSW 8 95756226 missense probably benign 0.02
R9601:Cnot1 UTSW 8 95756207 missense probably benign 0.02
R9629:Cnot1 UTSW 8 95729246 missense probably damaging 0.98
R9752:Cnot1 UTSW 8 95761391 missense probably damaging 1.00
R9764:Cnot1 UTSW 8 95769581 missense probably benign 0.00
R9789:Cnot1 UTSW 8 95729144 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- AACTCATTCAGAATACAGCGGAAG -3'
(R):5'- GATTGCAAATAACGCCTACAGAAG -3'

Sequencing Primer
(F):5'- TCTACGGAGTGAATTTCAGGACAGTC -3'
(R):5'- TATCCAGAAAACCAATAGTAAATCGC -3'
Posted On 2016-04-27