Incidental Mutation 'R4971:Tbc1d2b'
ID384455
Institutional Source Beutler Lab
Gene Symbol Tbc1d2b
Ensembl Gene ENSMUSG00000037410
Gene NameTBC1 domain family, member 2B
Synonyms1810061M12Rik
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4971 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90202027-90270804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90218870 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 689 (M689K)
Ref Sequence ENSEMBL: ENSMUSP00000045413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041767]
Predicted Effect probably benign
Transcript: ENSMUST00000041767
AA Change: M689K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045413
Gene: ENSMUSG00000037410
AA Change: M689K

DomainStartEndE-ValueType
PH 35 141 2.66e-9 SMART
low complexity region 324 334 N/A INTRINSIC
low complexity region 343 356 N/A INTRINSIC
Blast:TBC 358 601 2e-25 BLAST
TBC 661 881 3.75e-60 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120385
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Cnot1 A G 8: 95,721,626 F2266S probably damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Pdlim2 A G 14: 70,167,759 V219A probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Rhot1 T A 11: 80,233,474 I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Slc13a3 A G 2: 165,448,699 I67T probably damaging Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zfp456 T C 13: 67,366,876 E237G probably benign Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Tbc1d2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Tbc1d2b APN 9 90226209 missense probably benign
IGL00791:Tbc1d2b APN 9 90227428 missense probably benign 0.18
IGL01457:Tbc1d2b APN 9 90205091 missense probably damaging 1.00
IGL01535:Tbc1d2b APN 9 90215473 splice site probably benign
IGL02089:Tbc1d2b APN 9 90222359 missense possibly damaging 0.80
IGL02409:Tbc1d2b APN 9 90222352 missense probably benign 0.00
IGL02799:Tbc1d2b APN 9 90223434 splice site probably benign
IGL03198:Tbc1d2b APN 9 90222457 missense probably damaging 1.00
Leone UTSW 9 90207887 missense probably damaging 1.00
panthera UTSW 9 90226248 missense probably benign
pardo UTSW 9 90219144 missense probably benign 0.13
pardus UTSW 9 90219010 nonsense probably null
roar UTSW 9 90218922 nonsense probably null
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0062:Tbc1d2b UTSW 9 90222302 splice site probably benign
R0671:Tbc1d2b UTSW 9 90222505 splice site probably benign
R0682:Tbc1d2b UTSW 9 90249862 missense probably benign 0.01
R1074:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1075:Tbc1d2b UTSW 9 90222340 missense possibly damaging 0.68
R1140:Tbc1d2b UTSW 9 90226376 missense possibly damaging 0.91
R1892:Tbc1d2b UTSW 9 90218943 missense probably damaging 0.98
R4064:Tbc1d2b UTSW 9 90218922 nonsense probably null
R4541:Tbc1d2b UTSW 9 90205169 missense probably damaging 1.00
R4590:Tbc1d2b UTSW 9 90270500 missense possibly damaging 0.81
R4651:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R4652:Tbc1d2b UTSW 9 90207887 missense probably damaging 1.00
R5086:Tbc1d2b UTSW 9 90227457 missense probably benign
R5131:Tbc1d2b UTSW 9 90209759 missense probably damaging 1.00
R5205:Tbc1d2b UTSW 9 90207810 missense probably damaging 1.00
R5502:Tbc1d2b UTSW 9 90227443 missense probably benign
R5509:Tbc1d2b UTSW 9 90218969 missense probably damaging 1.00
R5534:Tbc1d2b UTSW 9 90227506 missense possibly damaging 0.89
R5729:Tbc1d2b UTSW 9 90207872 missense probably benign 0.22
R5735:Tbc1d2b UTSW 9 90222409 missense possibly damaging 0.71
R5847:Tbc1d2b UTSW 9 90209724 missense probably damaging 1.00
R5928:Tbc1d2b UTSW 9 90219144 missense probably benign 0.13
R6595:Tbc1d2b UTSW 9 90226092 missense probably benign 0.02
R6766:Tbc1d2b UTSW 9 90226209 missense probably benign
R7563:Tbc1d2b UTSW 9 90219010 nonsense probably null
R7563:Tbc1d2b UTSW 9 90226248 missense probably benign
X0066:Tbc1d2b UTSW 9 90218658 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGCTTTTCTTAGGCTGACACC -3'
(R):5'- TTTCCACTGGGGTCAAGTG -3'

Sequencing Primer
(F):5'- TTCAGGCCTTGGCAGTAGC -3'
(R):5'- TGGGAAAACTATTTTGCGAGCAC -3'
Posted On2016-04-27