Incidental Mutation 'R4971:Zfp456'
ID384465
Institutional Source Beutler Lab
Gene Symbol Zfp456
Ensembl Gene ENSMUSG00000078995
Gene Namezinc finger protein 456
SynonymsRslcan-13
MMRRC Submission 042566-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R4971 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67362113-67375810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67366876 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 237 (E237G)
Ref Sequence ENSEMBL: ENSMUSP00000059686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057070] [ENSMUST00000166080] [ENSMUST00000172266]
Predicted Effect probably benign
Transcript: ENSMUST00000057070
AA Change: E237G

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059686
Gene: ENSMUSG00000078995
AA Change: E237G

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
ZnF_C2H2 106 128 1.92e-2 SMART
ZnF_C2H2 134 156 5.77e0 SMART
ZnF_C2H2 162 184 1.28e-3 SMART
ZnF_C2H2 190 212 2.36e-2 SMART
ZnF_C2H2 246 268 2.17e-1 SMART
ZnF_C2H2 274 296 7.37e-4 SMART
ZnF_C2H2 302 324 6.32e-3 SMART
ZnF_C2H2 330 352 2.4e-3 SMART
ZnF_C2H2 358 380 8.94e-3 SMART
ZnF_C2H2 386 408 1.92e-2 SMART
ZnF_C2H2 414 436 7.9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165145
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172266
SMART Domains Protein: ENSMUSP00000130928
Gene: ENSMUSG00000078995

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,325,599 probably benign Het
A2ml1 A T 6: 128,547,227 F1147L probably damaging Het
Abca2 T C 2: 25,441,994 S1373P probably damaging Het
Abca9 A T 11: 110,152,048 S392T probably benign Het
Abcd2 T C 15: 91,163,110 D580G probably benign Het
Actl9 T A 17: 33,433,908 L314H probably damaging Het
Adamtsl1 T C 4: 86,336,931 F746L probably damaging Het
Anks6 C T 4: 47,030,795 G601S probably damaging Het
Cd3eap T C 7: 19,357,562 N207D probably benign Het
Cdkl3 T C 11: 52,011,168 V68A possibly damaging Het
Cnot1 A G 8: 95,721,626 F2266S probably damaging Het
Colq T C 14: 31,545,077 R159G probably damaging Het
Ctse A T 1: 131,664,392 D152V probably damaging Het
Cul7 G T 17: 46,659,119 M1011I probably benign Het
Cyb5r4 G T 9: 87,057,171 V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 H1619Q probably benign Het
Eif2ak1 A G 5: 143,882,168 K216E probably damaging Het
F5 A T 1: 164,194,186 H1410L probably benign Het
Frem2 T C 3: 53,539,183 Y2388C probably damaging Het
Fsip2 C T 2: 82,985,878 T3985M probably benign Het
Gak T C 5: 108,596,806 Y535C probably damaging Het
Gm15448 T A 7: 3,822,806 M355L probably benign Het
Gzmc G T 14: 56,232,369 P158Q probably damaging Het
Hook3 A G 8: 26,082,579 Y135H probably benign Het
Ikbke GCC G 1: 131,275,267 probably null Het
Ing4 A T 6: 125,043,998 M28L probably benign Het
Irs3 T A 5: 137,644,492 D228V probably damaging Het
Jade1 T A 3: 41,601,401 I301N probably damaging Het
Kif13b T A 14: 64,757,562 M921K possibly damaging Het
Kmt2c A G 5: 25,310,872 S2658P probably benign Het
Map3k4 A G 17: 12,249,495 probably null Het
Map4k5 C T 12: 69,852,719 V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 S3694P probably damaging Het
Mgea5 C A 19: 45,770,046 probably null Het
Mroh7 A G 4: 106,691,552 V1038A probably benign Het
Muc5ac T C 7: 141,816,278 V3185A possibly damaging Het
Mup5 T A 4: 61,833,060 N117I probably benign Het
Myo19 T A 11: 84,892,197 M179K probably damaging Het
Myo1c A G 11: 75,671,588 Y902C probably damaging Het
Nf1 T A 11: 79,444,643 I977K probably damaging Het
Nos1 T C 5: 117,943,834 V1240A probably benign Het
Nr3c1 T C 18: 39,486,877 D119G probably damaging Het
Olfr1212 A T 2: 88,958,519 N18Y probably damaging Het
Pdlim2 A G 14: 70,167,759 V219A probably damaging Het
Prdx1 T C 4: 116,691,931 probably null Het
Rbfox1 C T 16: 7,294,088 R173C probably damaging Het
Rbp3 T A 14: 33,954,470 V125D probably damaging Het
Rhot1 T A 11: 80,233,474 I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 R129C probably damaging Het
Setbp1 A G 18: 78,858,167 S762P probably benign Het
Slc13a3 A G 2: 165,448,699 I67T probably damaging Het
Tbc1d2b A T 9: 90,218,870 M689K probably benign Het
Top2a T C 11: 98,993,841 Y1517C probably damaging Het
Txndc2 A T 17: 65,638,854 N109K probably damaging Het
Tyk2 A G 9: 21,120,501 probably null Het
Wdfy3 A T 5: 101,948,972 L320* probably null Het
Zscan10 A G 17: 23,607,173 E103G possibly damaging Het
Other mutations in Zfp456
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Zfp456 APN 13 67367153 missense probably benign 0.06
IGL03200:Zfp456 APN 13 67366477 missense probably benign
IGL03406:Zfp456 APN 13 67366331 missense probably damaging 0.98
R0667:Zfp456 UTSW 13 67366742 missense probably benign 0.00
R0729:Zfp456 UTSW 13 67366544 missense probably damaging 1.00
R1731:Zfp456 UTSW 13 67366555 missense probably benign 0.39
R1832:Zfp456 UTSW 13 67367363 missense probably benign 0.09
R2011:Zfp456 UTSW 13 67366874 nonsense probably null
R2022:Zfp456 UTSW 13 67366497 nonsense probably null
R2023:Zfp456 UTSW 13 67366497 nonsense probably null
R2438:Zfp456 UTSW 13 67366954 missense probably damaging 1.00
R2516:Zfp456 UTSW 13 67362372 missense probably benign 0.00
R2896:Zfp456 UTSW 13 67367297 missense possibly damaging 0.52
R3964:Zfp456 UTSW 13 67366781 missense probably benign 0.03
R4930:Zfp456 UTSW 13 67366946 missense probably benign
R5357:Zfp456 UTSW 13 67372209 missense possibly damaging 0.71
R5754:Zfp456 UTSW 13 67366240 missense probably benign 0.40
R5795:Zfp456 UTSW 13 67366920 missense probably benign
R6339:Zfp456 UTSW 13 67362364 nonsense probably null
R6904:Zfp456 UTSW 13 67366265 missense probably benign 0.44
R7071:Zfp456 UTSW 13 67372777 missense probably damaging 1.00
R7690:Zfp456 UTSW 13 67366794 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTTGTAGGGTTTGTCTTCAG -3'
(R):5'- ATCTCATCTTTGGCTCAACAGG -3'

Sequencing Primer
(F):5'- TCAGAGTGAAGGGTTTGATGTC -3'
(R):5'- GAGTGTCATAAGGCCTTCAGTACTC -3'
Posted On2016-04-27