Incidental Mutation 'R4971:Pdlim2'
ID 384471
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene Name PDZ and LIM domain 2
Synonyms SLIM, 4732462F18Rik, mystique
MMRRC Submission 042566-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R4971 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 70401667-70415130 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70405208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 219 (V219A)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000153735] [ENSMUST00000143393]
AlphaFold Q8R1G6
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: V219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: V219A

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123125
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: V20A
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: V20A

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127836
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129174
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: V219A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: V219A

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,524,190 (GRCm39) F1147L probably damaging Het
Abca2 T C 2: 25,332,006 (GRCm39) S1373P probably damaging Het
Abca9 A T 11: 110,042,874 (GRCm39) S392T probably benign Het
Abcd2 T C 15: 91,047,313 (GRCm39) D580G probably benign Het
Actl9 T A 17: 33,652,882 (GRCm39) L314H probably damaging Het
Adamtsl1 T C 4: 86,255,168 (GRCm39) F746L probably damaging Het
Anks6 C T 4: 47,030,795 (GRCm39) G601S probably damaging Het
Cdkl3 T C 11: 51,901,995 (GRCm39) V68A possibly damaging Het
Cnot1 A G 8: 96,448,254 (GRCm39) F2266S probably damaging Het
Colq T C 14: 31,267,034 (GRCm39) R159G probably damaging Het
Ctse A T 1: 131,592,130 (GRCm39) D152V probably damaging Het
Cul7 G T 17: 46,970,045 (GRCm39) M1011I probably benign Het
Cyb5r4 G T 9: 86,939,224 (GRCm39) V336L possibly damaging Het
Dync2h1 A T 9: 7,131,949 (GRCm39) H1619Q probably benign Het
Eif2ak1 A G 5: 143,818,986 (GRCm39) K216E probably damaging Het
F5 A T 1: 164,021,755 (GRCm39) H1410L probably benign Het
Frem2 T C 3: 53,446,604 (GRCm39) Y2388C probably damaging Het
Fsip2 C T 2: 82,816,222 (GRCm39) T3985M probably benign Het
Gak T C 5: 108,744,672 (GRCm39) Y535C probably damaging Het
Gzmc G T 14: 56,469,826 (GRCm39) P158Q probably damaging Het
Hook3 A G 8: 26,572,607 (GRCm39) Y135H probably benign Het
Ikbke GCC G 1: 131,203,004 (GRCm39) probably null Het
Ing4 A T 6: 125,020,961 (GRCm39) M28L probably benign Het
Irs3 T A 5: 137,642,754 (GRCm39) D228V probably damaging Het
Jade1 T A 3: 41,555,836 (GRCm39) I301N probably damaging Het
Kif13b T A 14: 64,995,011 (GRCm39) M921K possibly damaging Het
Kmt2c A G 5: 25,515,870 (GRCm39) S2658P probably benign Het
Map3k4 A G 17: 12,468,382 (GRCm39) probably null Het
Map4k5 C T 12: 69,899,493 (GRCm39) V53I possibly damaging Het
Mdn1 T C 4: 32,739,827 (GRCm39) S3694P probably damaging Het
Mroh7 A G 4: 106,548,749 (GRCm39) V1038A probably benign Het
Muc5ac T C 7: 141,370,015 (GRCm39) V3185A possibly damaging Het
Mup5 T A 4: 61,751,297 (GRCm39) N117I probably benign Het
Myo19 T A 11: 84,783,023 (GRCm39) M179K probably damaging Het
Myo1c A G 11: 75,562,414 (GRCm39) Y902C probably damaging Het
Nf1 T A 11: 79,335,469 (GRCm39) I977K probably damaging Het
Nos1 T C 5: 118,081,899 (GRCm39) V1240A probably benign Het
Nr3c1 T C 18: 39,619,930 (GRCm39) D119G probably damaging Het
Oga C A 19: 45,758,485 (GRCm39) probably null Het
Or4c107 A T 2: 88,788,863 (GRCm39) N18Y probably damaging Het
Pira13 T A 7: 3,825,805 (GRCm39) M355L probably benign Het
Polr1g T C 7: 19,091,487 (GRCm39) N207D probably benign Het
Prdx1 T C 4: 116,549,128 (GRCm39) probably null Het
Rbfox1 C T 16: 7,111,952 (GRCm39) R173C probably damaging Het
Rbp3 T A 14: 33,676,427 (GRCm39) V125D probably damaging Het
Resf1 T C 6: 149,227,097 (GRCm39) probably benign Het
Rhot1 T A 11: 80,124,300 (GRCm39) I154K probably damaging Het
Runx1t1 C T 4: 13,837,978 (GRCm39) R129C probably damaging Het
Setbp1 A G 18: 78,901,382 (GRCm39) S762P probably benign Het
Slc13a3 A G 2: 165,290,619 (GRCm39) I67T probably damaging Het
Tbc1d2b A T 9: 90,100,923 (GRCm39) M689K probably benign Het
Top2a T C 11: 98,884,667 (GRCm39) Y1517C probably damaging Het
Txndc2 A T 17: 65,945,849 (GRCm39) N109K probably damaging Het
Tyk2 A G 9: 21,031,797 (GRCm39) probably null Het
Wdfy3 A T 5: 102,096,838 (GRCm39) L320* probably null Het
Zfp456 T C 13: 67,514,995 (GRCm39) E237G probably benign Het
Zscan10 A G 17: 23,826,147 (GRCm39) E103G possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70,403,532 (GRCm39) splice site probably benign
IGL02338:Pdlim2 APN 14 70,411,906 (GRCm39) missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70,411,925 (GRCm39) missense possibly damaging 0.88
PIT4504001:Pdlim2 UTSW 14 70,403,579 (GRCm39) missense probably benign 0.44
R0751:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70,411,773 (GRCm39) splice site probably benign
R1595:Pdlim2 UTSW 14 70,402,193 (GRCm39) missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70,408,688 (GRCm39) missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70,411,784 (GRCm39) critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1924:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70,403,549 (GRCm39) missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70,402,228 (GRCm39) missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70,405,464 (GRCm39) unclassified probably benign
R5951:Pdlim2 UTSW 14 70,405,229 (GRCm39) missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70,405,137 (GRCm39) missense probably damaging 1.00
R7208:Pdlim2 UTSW 14 70,411,826 (GRCm39) missense probably damaging 1.00
R7597:Pdlim2 UTSW 14 70,403,645 (GRCm39) missense possibly damaging 0.58
R7627:Pdlim2 UTSW 14 70,408,924 (GRCm39) missense probably benign
R8342:Pdlim2 UTSW 14 70,403,563 (GRCm39) missense probably damaging 1.00
R8554:Pdlim2 UTSW 14 70,408,698 (GRCm39) missense probably benign
R9361:Pdlim2 UTSW 14 70,402,190 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCATGGATCCTTAAGCTAC -3'
(R):5'- GTTCAGGTACTAGCAGGTCTTG -3'

Sequencing Primer
(F):5'- ATGGATCCTTAAGCTACTTCCTTAG -3'
(R):5'- GCAGAGTTGGGTGAGCTCC -3'
Posted On 2016-04-27