Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Il18r1'

384482

Institutional Source

Beutler Lab

Gene Symbol

Il18r1

Ensembl Gene

ENSMUSG00000026070

Gene Name

interleukin 18 receptor 1

Synonyms

Il18ralpha, Il1rrp

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

40465552-40500854 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 40491064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 317 (P317L)

Ref Sequence

ENSEMBL: ENSMUSP00000141695 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]

AlphaFold

Q61098

Predicted Effect

probably benign
Transcript: ENSMUST00000087983
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: P317L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108044
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: P317L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167723
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: P317L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193391
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: P317L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193793

SMART Domains

Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	3.7e-3	SMART
IG_like	132	189	9.7e-3	SMART
Pfam:Ig_2	214	263	5.2e-1	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195684
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: P317L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IG	25	113	8.93e-1	SMART
IG_like	126	204	7.06e0	SMART
IG	219	315	3.63e0	SMART
transmembrane domain	326	348	N/A	INTRINSIC
TIR	371	519	3.8e-37	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Il18r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Il18r1	APN	1	40498652	missense	possibly damaging	0.68
IGL00742:Il18r1	APN	1	40480991	missense	probably benign	0.11
IGL01448:Il18r1	APN	1	40474730	missense	probably damaging	1.00
IGL01726:Il18r1	APN	1	40498403	missense	possibly damaging	0.83
IGL02081:Il18r1	APN	1	40498505	missense	probably damaging	1.00
IGL02425:Il18r1	APN	1	40491221	splice site	probably benign
IGL02447:Il18r1	APN	1	40498337	critical splice acceptor site	probably null
IGL02529:Il18r1	APN	1	40487059	missense	possibly damaging	0.77
IGL02863:Il18r1	APN	1	40487007	missense	probably damaging	1.00
IGL02928:Il18r1	APN	1	40478551	critical splice donor site	probably null
IGL02941:Il18r1	APN	1	40498551	missense	probably damaging	0.99
IGL03156:Il18r1	APN	1	40498368	missense	possibly damaging	0.92
R0532:Il18r1	UTSW	1	40474901	missense	probably damaging	0.97
R0926:Il18r1	UTSW	1	40487028	missense	probably damaging	1.00
R1909:Il18r1	UTSW	1	40474914	missense	probably damaging	1.00
R2212:Il18r1	UTSW	1	40491067	missense	probably damaging	1.00
R2254:Il18r1	UTSW	1	40491220	missense	possibly damaging	0.91
R2860:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R2861:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R2862:Il18r1	UTSW	1	40498557	missense	possibly damaging	0.49
R3412:Il18r1	UTSW	1	40491067	missense	probably damaging	1.00
R3432:Il18r1	UTSW	1	40487089	missense	probably damaging	0.99
R3718:Il18r1	UTSW	1	40495788	missense	probably benign	0.00
R3816:Il18r1	UTSW	1	40486972	splice site	probably benign
R3894:Il18r1	UTSW	1	40474874	missense	possibly damaging	0.79
R4061:Il18r1	UTSW	1	40474936	missense	probably benign	0.33
R4062:Il18r1	UTSW	1	40474936	missense	probably benign	0.33
R4381:Il18r1	UTSW	1	40471790	missense	probably benign	0.00
R5059:Il18r1	UTSW	1	40481067	critical splice donor site	probably null
R6229:Il18r1	UTSW	1	40474763	missense	probably benign	0.02
R6458:Il18r1	UTSW	1	40491182	nonsense	probably null
R6505:Il18r1	UTSW	1	40489707	missense	probably benign
R6738:Il18r1	UTSW	1	40498656	missense	probably benign	0.06
R7002:Il18r1	UTSW	1	40474853	missense	probably benign	0.39
R7317:Il18r1	UTSW	1	40474832	missense	possibly damaging	0.80
R7485:Il18r1	UTSW	1	40480980	missense	probably benign	0.01
R7510:Il18r1	UTSW	1	40474875	missense	probably benign	0.03
R7515:Il18r1	UTSW	1	40498670	missense	not run
R7526:Il18r1	UTSW	1	40471772	missense	probably damaging	0.99
R7793:Il18r1	UTSW	1	40471764	missense	probably benign	0.01
R7870:Il18r1	UTSW	1	40491136	missense	probably benign	0.45
R8004:Il18r1	UTSW	1	40474757	missense	probably damaging	1.00
R8063:Il18r1	UTSW	1	40487038	missense	probably benign	0.10
R8836:Il18r1	UTSW	1	40495856	missense	probably benign	0.15
R9304:Il18r1	UTSW	1	40471733	start gained	probably benign
R9502:Il18r1	UTSW	1	40489692	missense	probably benign	0.01
R9507:Il18r1	UTSW	1	40474724	missense	probably damaging	0.99
R9559:Il18r1	UTSW	1	40489633	missense	probably benign	0.01
X0023:Il18r1	UTSW	1	40471761	missense	probably benign	0.04
X0064:Il18r1	UTSW	1	40495713	splice site	probably null
Z1088:Il18r1	UTSW	1	40474751	missense	probably damaging	1.00
Z1088:Il18r1	UTSW	1	40478486	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCCACTGTAGACTACCAGC -3'
(R):5'- AAACATGAGCTAGGGTGCCC -3'

Sequencing Primer
(F):5'- CTGTAGACTACCAGCAGGAGTGTG -3'
(R):5'- CCTGTCACAGCAGCATATTACCTG -3'

Posted On

2016-04-27