Incidental Mutation 'R4972:Il18r1'
ID 384482
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Name interleukin 18 receptor 1
Synonyms Il1rrp, Il18ralpha
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4972 (G1)
Quality Score 92
Status Validated
Chromosome 1
Chromosomal Location 40504712-40540014 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40530224 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 317 (P317L)
Ref Sequence ENSEMBL: ENSMUSP00000141695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]
AlphaFold Q61098
Predicted Effect probably benign
Transcript: ENSMUST00000087983
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108044
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167723
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193391
AA Change: P317L

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193793
SMART Domains Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 3.7e-3 SMART
IG_like 132 189 9.7e-3 SMART
Pfam:Ig_2 214 263 5.2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195684
AA Change: P317L

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: P317L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40,537,812 (GRCm39) missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40,520,151 (GRCm39) missense probably benign 0.11
IGL01448:Il18r1 APN 1 40,513,890 (GRCm39) missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40,537,563 (GRCm39) missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40,537,665 (GRCm39) missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40,530,381 (GRCm39) splice site probably benign
IGL02447:Il18r1 APN 1 40,537,497 (GRCm39) critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40,526,219 (GRCm39) missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40,526,167 (GRCm39) missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40,517,711 (GRCm39) critical splice donor site probably null
IGL02941:Il18r1 APN 1 40,537,711 (GRCm39) missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40,537,528 (GRCm39) missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40,514,061 (GRCm39) missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40,526,188 (GRCm39) missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40,514,074 (GRCm39) missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40,530,227 (GRCm39) missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40,530,380 (GRCm39) missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40,537,717 (GRCm39) missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40,537,717 (GRCm39) missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40,537,717 (GRCm39) missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40,530,227 (GRCm39) missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40,526,249 (GRCm39) missense probably damaging 0.99
R3718:Il18r1 UTSW 1 40,534,948 (GRCm39) missense probably benign 0.00
R3816:Il18r1 UTSW 1 40,526,132 (GRCm39) splice site probably benign
R3894:Il18r1 UTSW 1 40,514,034 (GRCm39) missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40,514,096 (GRCm39) missense probably benign 0.33
R4062:Il18r1 UTSW 1 40,514,096 (GRCm39) missense probably benign 0.33
R4381:Il18r1 UTSW 1 40,510,950 (GRCm39) missense probably benign 0.00
R5059:Il18r1 UTSW 1 40,520,227 (GRCm39) critical splice donor site probably null
R6229:Il18r1 UTSW 1 40,513,923 (GRCm39) missense probably benign 0.02
R6458:Il18r1 UTSW 1 40,530,342 (GRCm39) nonsense probably null
R6505:Il18r1 UTSW 1 40,528,867 (GRCm39) missense probably benign
R6738:Il18r1 UTSW 1 40,537,816 (GRCm39) missense probably benign 0.06
R7002:Il18r1 UTSW 1 40,514,013 (GRCm39) missense probably benign 0.39
R7317:Il18r1 UTSW 1 40,513,992 (GRCm39) missense possibly damaging 0.80
R7485:Il18r1 UTSW 1 40,520,140 (GRCm39) missense probably benign 0.01
R7510:Il18r1 UTSW 1 40,514,035 (GRCm39) missense probably benign 0.03
R7515:Il18r1 UTSW 1 40,537,830 (GRCm39) missense not run
R7526:Il18r1 UTSW 1 40,510,932 (GRCm39) missense probably damaging 0.99
R7793:Il18r1 UTSW 1 40,510,924 (GRCm39) missense probably benign 0.01
R7870:Il18r1 UTSW 1 40,530,296 (GRCm39) missense probably benign 0.45
R8004:Il18r1 UTSW 1 40,513,917 (GRCm39) missense probably damaging 1.00
R8063:Il18r1 UTSW 1 40,526,198 (GRCm39) missense probably benign 0.10
R8836:Il18r1 UTSW 1 40,535,016 (GRCm39) missense probably benign 0.15
R9304:Il18r1 UTSW 1 40,510,893 (GRCm39) start gained probably benign
R9502:Il18r1 UTSW 1 40,528,852 (GRCm39) missense probably benign 0.01
R9507:Il18r1 UTSW 1 40,513,884 (GRCm39) missense probably damaging 0.99
R9559:Il18r1 UTSW 1 40,528,793 (GRCm39) missense probably benign 0.01
X0023:Il18r1 UTSW 1 40,510,921 (GRCm39) missense probably benign 0.04
X0064:Il18r1 UTSW 1 40,534,873 (GRCm39) splice site probably null
Z1088:Il18r1 UTSW 1 40,517,646 (GRCm39) missense probably damaging 0.99
Z1088:Il18r1 UTSW 1 40,513,911 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCACTGTAGACTACCAGC -3'
(R):5'- AAACATGAGCTAGGGTGCCC -3'

Sequencing Primer
(F):5'- CTGTAGACTACCAGCAGGAGTGTG -3'
(R):5'- CCTGTCACAGCAGCATATTACCTG -3'
Posted On 2016-04-27