Incidental Mutation 'R4972:Mob4'
ID 384483
Institutional Source Beutler Lab
Gene Symbol Mob4
Ensembl Gene ENSMUSG00000025979
Gene Name MOB family member 4, phocein
Synonyms Mobkl3, Prei3
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 55131231-55154899 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 55151002 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Valine at position 135 (L135V)
Ref Sequence ENSEMBL: ENSMUSP00000124790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027122] [ENSMUST00000159311] [ENSMUST00000161122] [ENSMUST00000162364] [ENSMUST00000162553]
AlphaFold Q6PEB6
Predicted Effect probably benign
Transcript: ENSMUST00000027122
AA Change: L114V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027122
Gene: ENSMUSG00000025979
AA Change: L114V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 28 168 1.2e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159311
AA Change: L135V

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124790
Gene: ENSMUSG00000025979
AA Change: L135V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 19 189 9.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161122
Predicted Effect possibly damaging
Transcript: ENSMUST00000162364
AA Change: L156V

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125415
Gene: ENSMUSG00000025979
AA Change: L156V

DomainStartEndE-ValueType
Mob1_phocein 42 209 1.89e-58 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162553
AA Change: L124V

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124151
Gene: ENSMUSG00000025979
AA Change: L124V

DomainStartEndE-ValueType
Pfam:Mob1_phocein 8 178 3.9e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187422
Meta Mutation Damage Score 0.5154 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on its similarity with the mouse counterpart. Studies of the mouse counterpart suggest that the expression of this gene may be regulated during oocyte maturation and preimplantation following zygotic gene activation. Alternatively spliced transcript variants encoding distinct isoforms have been observed. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HSPE1.[provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Mob4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03340:Mob4 APN 1 55136708 missense possibly damaging 0.50
R4756:Mob4 UTSW 1 55152696 missense probably damaging 0.98
R4831:Mob4 UTSW 1 55152740 missense probably benign 0.01
R4832:Mob4 UTSW 1 55145252 intron probably benign
R4876:Mob4 UTSW 1 55152836 unclassified probably benign
R5747:Mob4 UTSW 1 55148578 missense probably damaging 1.00
R6717:Mob4 UTSW 1 55136713 missense possibly damaging 0.91
R6774:Mob4 UTSW 1 55148429 splice site probably null
R6925:Mob4 UTSW 1 55152722 nonsense probably null
R7447:Mob4 UTSW 1 55131466 start gained probably benign
R7721:Mob4 UTSW 1 55148320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAAAAGCCTGTGCACTGC -3'
(R):5'- GCCTTAAGTTACTGCCCTGAC -3'

Sequencing Primer
(F):5'- ACTGCAGCCTTGATCCAGATG -3'
(R):5'- GACTTTCCCAGTAATGGAGTGTAACC -3'
Posted On 2016-04-27