Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Spag16'

384485

Institutional Source

Beutler Lab

Gene Symbol

Spag16

Ensembl Gene

ENSMUSG00000053153

Gene Name

sperm associated antigen 16

Synonyms

4930585K05Rik, Pf20, 4930524F24Rik, Wdr29, 4921511D23Rik

MMRRC Submission

042567-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69826970-70725132 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70724928 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 636 (R636W)

Ref Sequence

ENSEMBL: ENSMUSP00000069821 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053922] [ENSMUST00000065425] [ENSMUST00000161937] [ENSMUST00000162182]

AlphaFold

Q8K450

Predicted Effect

probably benign
Transcript: ENSMUST00000053922

SMART Domains

Protein: ENSMUSP00000058142
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
VWC	53	109	4.18e0	SMART
VWC	116	171	2.49e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000065425
AA Change: R636W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000069821
Gene: ENSMUSG00000053153
AA Change: R636W

Domain	Start	End	E-Value	Type
low complexity region	45	55	N/A	INTRINSIC
coiled coil region	146	190	N/A	INTRINSIC
WD40	349	388	7.8e-2	SMART
WD40	391	430	6.23e-10	SMART
WD40	433	472	1.34e-9	SMART
WD40	475	514	1.92e-10	SMART
WD40	517	556	2.38e-6	SMART
WD40	559	598	1.42e2	SMART
WD40	600	639	4.83e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159205

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161310

Predicted Effect

probably benign
Transcript: ENSMUST00000161937

SMART Domains

Protein: ENSMUSP00000125014
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:VWC_def	53	109	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162182

SMART Domains

Protein: ENSMUSP00000123819
Gene: ENSMUSG00000045648

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Blast:VWC_def	33	62	4e-12	BLAST
VWC	69	124	2.49e-5	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008]
PHENOTYPE: Chimeric males carrying one copy of the mutated allele have impaired spermatogenesis, a significant loss of germ cells at the round spermatid stage, and disorganized sperm axoneme structure. No offspring carrying the mutated allele are produced from matings using male chimeras. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Spag16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00793:Spag16	APN	1	70299650	missense	probably damaging	1.00
IGL01129:Spag16	APN	1	69896522	missense	probably benign	0.01
IGL02117:Spag16	APN	1	69870320	missense	probably damaging	1.00
IGL02245:Spag16	APN	1	69858502	missense	probably benign
IGL02492:Spag16	APN	1	69887529	missense	probably benign
IGL02851:Spag16	APN	1	70264908	missense	possibly damaging	0.76
IGL03271:Spag16	APN	1	69853352	missense	probably benign	0.00
IGL03274:Spag16	APN	1	69844381	splice site	probably benign
PIT4243001:Spag16	UTSW	1	69853381	missense	probably damaging	1.00
R0084:Spag16	UTSW	1	69996839	missense	probably benign	0.02
R0513:Spag16	UTSW	1	70493768	splice site	probably benign
R0653:Spag16	UTSW	1	69870345	missense	probably damaging	1.00
R1165:Spag16	UTSW	1	69996877	missense	probably benign	0.04
R1178:Spag16	UTSW	1	69923658	splice site	probably benign
R1180:Spag16	UTSW	1	69923658	splice site	probably benign
R1404:Spag16	UTSW	1	69895280	splice site	probably benign
R1547:Spag16	UTSW	1	69873243	missense	possibly damaging	0.51
R1689:Spag16	UTSW	1	70461118	missense	probably benign	0.01
R1699:Spag16	UTSW	1	69996856	missense	probably benign	0.05
R1714:Spag16	UTSW	1	69843005	missense	probably damaging	0.97
R1724:Spag16	UTSW	1	70493782	missense	probably damaging	1.00
R1873:Spag16	UTSW	1	69896585	splice site	probably benign
R2196:Spag16	UTSW	1	69858522	missense	possibly damaging	0.92
R2207:Spag16	UTSW	1	70724884	missense	probably benign	0.00
R4058:Spag16	UTSW	1	69853328	missense	probably damaging	0.96
R4276:Spag16	UTSW	1	69873481	intron	probably benign
R4497:Spag16	UTSW	1	70493830	missense	probably damaging	1.00
R4560:Spag16	UTSW	1	69844296	missense	probably benign	0.05
R4648:Spag16	UTSW	1	69827035	missense	probably null	0.99
R5027:Spag16	UTSW	1	69923804	intron	probably benign
R5032:Spag16	UTSW	1	69853352	missense	probably benign	0.00
R5174:Spag16	UTSW	1	70493796	missense	probably damaging	1.00
R5276:Spag16	UTSW	1	69896583	critical splice donor site	probably null
R5537:Spag16	UTSW	1	69827016	missense	probably benign
R5706:Spag16	UTSW	1	69870289	missense	probably benign	0.01
R5834:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R6131:Spag16	UTSW	1	70725083	splice site	probably null
R6246:Spag16	UTSW	1	69923821	missense	probably benign	0.45
R7164:Spag16	UTSW	1	70724866	missense	possibly damaging	0.88
R7261:Spag16	UTSW	1	70299621	missense	possibly damaging	0.56
R7298:Spag16	UTSW	1	69919426	splice site	probably null
R7358:Spag16	UTSW	1	69844367	missense	probably benign	0.00
R7431:Spag16	UTSW	1	69923872	missense	unknown
R7508:Spag16	UTSW	1	69887520	missense	possibly damaging	0.93
R7566:Spag16	UTSW	1	69870328	missense	probably damaging	1.00
R7570:Spag16	UTSW	1	69996841	missense	probably benign	0.00
R7598:Spag16	UTSW	1	69870308	missense	probably damaging	1.00
R7942:Spag16	UTSW	1	69827088	missense	probably benign	0.11
R8047:Spag16	UTSW	1	69842996	missense	probably damaging	1.00
R8132:Spag16	UTSW	1	70381302	missense	probably damaging	1.00
R8329:Spag16	UTSW	1	69895248	missense	probably benign	0.00
R8870:Spag16	UTSW	1	69996858	missense	probably benign	0.05
R8930:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8932:Spag16	UTSW	1	70299769	critical splice donor site	probably null
R8954:Spag16	UTSW	1	69996845	missense
R8998:Spag16	UTSW	1	69896547	missense	probably benign	0.00
R9077:Spag16	UTSW	1	70493771	splice site	probably benign
R9144:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9145:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9148:Spag16	UTSW	1	70381300	missense	probably damaging	1.00
R9160:Spag16	UTSW	1	69923714	missense	probably benign	0.00
R9192:Spag16	UTSW	1	69923848	missense	unknown
R9436:Spag16	UTSW	1	69853380	missense	probably damaging	0.96
R9582:Spag16	UTSW	1	69858558	missense	probably benign	0.00
R9660:Spag16	UTSW	1	69923683	missense	probably benign	0.03
R9666:Spag16	UTSW	1	70724913	missense	probably damaging	1.00
R9671:Spag16	UTSW	1	69844336	missense	probably benign	0.29
R9728:Spag16	UTSW	1	69923683	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTCCAGGTCGAGTTTTAGCTC -3'
(R):5'- CCCTGTCTCTAAATTCATAACCGG -3'

Sequencing Primer
(F):5'- CGAGTTTTAGCTCAGGCGAG -3'
(R):5'- GTCTCTAAATTCATAACCGGATGAG -3'

Posted On

2016-04-27