Incidental Mutation 'R4972:Swt1'
ID 384487
Institutional Source Beutler Lab
Gene Symbol Swt1
Ensembl Gene ENSMUSG00000052748
Gene Name SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms 1200016B10Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R4972 (G1)
Quality Score 222
Status Validated
Chromosome 1
Chromosomal Location 151243450-151304206 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 151299293 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 7 (S7G)
Ref Sequence ENSEMBL: ENSMUSP00000107514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064771] [ENSMUST00000065625] [ENSMUST00000111883]
AlphaFold Q9DBQ9
Predicted Effect probably benign
Transcript: ENSMUST00000064771
AA Change: S7G

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067516
Gene: ENSMUSG00000052748
AA Change: S7G

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
low complexity region 783 793 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065625
SMART Domains Protein: ENSMUSP00000068309
Gene: ENSMUSG00000053286

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
low complexity region 25 70 N/A INTRINSIC
ZnF_C2H2 116 142 7.49e0 SMART
ZnF_C2H2 181 203 2.49e-1 SMART
Pfam:TRM 220 563 6.9e-60 PFAM
Pfam:TRM 595 684 6.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111883
AA Change: S7G

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107514
Gene: ENSMUSG00000052748
AA Change: S7G

DomainStartEndE-ValueType
low complexity region 186 206 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
low complexity region 258 269 N/A INTRINSIC
PINc 395 522 1.94e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000129939
AA Change: S5G
SMART Domains Protein: ENSMUSP00000120483
Gene: ENSMUSG00000052748
AA Change: S5G

DomainStartEndE-ValueType
PINc 146 245 6.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131312
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188179
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Swt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Swt1 APN 1 151,286,890 (GRCm39) missense probably damaging 0.99
IGL01622:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01623:Swt1 APN 1 151,286,760 (GRCm39) missense probably benign 0.01
IGL01672:Swt1 APN 1 151,270,359 (GRCm39) critical splice donor site probably null
IGL01693:Swt1 APN 1 151,297,855 (GRCm39) missense probably benign 0.02
IGL02203:Swt1 APN 1 151,246,377 (GRCm39) missense probably benign 0.01
IGL03223:Swt1 APN 1 151,255,170 (GRCm39) missense possibly damaging 0.80
R0124:Swt1 UTSW 1 151,267,280 (GRCm39) missense probably damaging 1.00
R0496:Swt1 UTSW 1 151,287,021 (GRCm39) missense probably benign
R1037:Swt1 UTSW 1 151,246,320 (GRCm39) splice site probably benign
R1171:Swt1 UTSW 1 151,281,272 (GRCm39) missense probably damaging 1.00
R1270:Swt1 UTSW 1 151,260,142 (GRCm39) missense probably benign 0.00
R1883:Swt1 UTSW 1 151,299,284 (GRCm39) nonsense probably null
R2051:Swt1 UTSW 1 151,248,081 (GRCm39) missense probably damaging 1.00
R2110:Swt1 UTSW 1 151,279,636 (GRCm39) missense probably damaging 0.97
R2185:Swt1 UTSW 1 151,260,219 (GRCm39) missense probably damaging 1.00
R3688:Swt1 UTSW 1 151,267,240 (GRCm39) missense probably damaging 0.99
R3785:Swt1 UTSW 1 151,255,155 (GRCm39) missense probably benign 0.03
R4074:Swt1 UTSW 1 151,270,520 (GRCm39) missense probably benign
R4157:Swt1 UTSW 1 151,278,795 (GRCm39) missense probably damaging 1.00
R4660:Swt1 UTSW 1 151,283,348 (GRCm39) missense probably benign 0.18
R4761:Swt1 UTSW 1 151,276,853 (GRCm39) missense probably benign 0.43
R5141:Swt1 UTSW 1 151,287,145 (GRCm39) missense probably benign 0.04
R5227:Swt1 UTSW 1 151,278,727 (GRCm39) nonsense probably null
R5400:Swt1 UTSW 1 151,288,585 (GRCm39) missense probably benign 0.00
R5580:Swt1 UTSW 1 151,260,206 (GRCm39) missense probably benign 0.00
R5912:Swt1 UTSW 1 151,287,160 (GRCm39) missense probably damaging 1.00
R5945:Swt1 UTSW 1 151,286,921 (GRCm39) missense probably benign 0.01
R5973:Swt1 UTSW 1 151,278,700 (GRCm39) splice site probably null
R5979:Swt1 UTSW 1 151,283,339 (GRCm39) missense possibly damaging 0.94
R6242:Swt1 UTSW 1 151,283,365 (GRCm39) missense probably benign 0.41
R6283:Swt1 UTSW 1 151,260,084 (GRCm39) missense possibly damaging 0.78
R6951:Swt1 UTSW 1 151,273,019 (GRCm39) missense possibly damaging 0.88
R7009:Swt1 UTSW 1 151,246,381 (GRCm39) missense possibly damaging 0.94
R7165:Swt1 UTSW 1 151,264,428 (GRCm39) missense probably damaging 1.00
R7214:Swt1 UTSW 1 151,270,364 (GRCm39) missense possibly damaging 0.63
R7403:Swt1 UTSW 1 151,264,444 (GRCm39) missense probably benign 0.01
R7439:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7441:Swt1 UTSW 1 151,286,815 (GRCm39) missense probably benign 0.04
R7571:Swt1 UTSW 1 151,270,470 (GRCm39) missense probably benign 0.00
R8028:Swt1 UTSW 1 151,260,248 (GRCm39) missense probably benign 0.26
R8225:Swt1 UTSW 1 151,297,859 (GRCm39) missense possibly damaging 0.96
R9075:Swt1 UTSW 1 151,246,245 (GRCm39) intron probably benign
R9100:Swt1 UTSW 1 151,299,256 (GRCm39) critical splice donor site probably null
R9135:Swt1 UTSW 1 151,244,239 (GRCm39) missense possibly damaging 0.61
R9291:Swt1 UTSW 1 151,286,694 (GRCm39) missense probably damaging 0.96
R9292:Swt1 UTSW 1 151,278,787 (GRCm39) missense probably benign 0.00
R9368:Swt1 UTSW 1 151,286,767 (GRCm39) missense possibly damaging 0.90
X0062:Swt1 UTSW 1 151,287,190 (GRCm39) missense probably benign 0.43
Z1176:Swt1 UTSW 1 151,264,436 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGGGTGAATTCATTTTCCTCAG -3'
(R):5'- CAGGGGTAATTGAAATTACTTGGC -3'

Sequencing Primer
(F):5'- GGTGAATTCATTTTCCTCAGTGTATC -3'
(R):5'- GAAATTACTTGGCTTATAGCGTTTG -3'
Posted On 2016-04-27