Incidental Mutation 'R4972:Lcn6'
ID 384491
Institutional Source Beutler Lab
Gene Symbol Lcn6
Ensembl Gene ENSMUSG00000045684
Gene Name lipocalin 6
Synonyms 9230101D24Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R4972 (G1)
Quality Score 163
Status Validated
Chromosome 2
Chromosomal Location 25566798-25571620 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 25570079 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 82 (C82S)
Ref Sequence ENSEMBL: ENSMUSP00000109837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058912] [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
AlphaFold A2AJB9
Predicted Effect probably benign
Transcript: ENSMUST00000058912
SMART Domains Protein: ENSMUSP00000059353
Gene: ENSMUSG00000047356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Lipocalin 36 169 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059693
AA Change: C16S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684
AA Change: C16S

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114197
AA Change: C16S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684
AA Change: C16S

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114199
AA Change: C82S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684
AA Change: C82S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139441
Meta Mutation Damage Score 0.8506 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype PHENOTYPE: Mice with loss of expression in the testes show premature acrosome reaction and elevated intracellular calcium levels in sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Lcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Lcn6 APN 2 25,570,792 (GRCm39) missense probably benign 0.29
R0747:Lcn6 UTSW 2 25,567,184 (GRCm39) missense probably damaging 1.00
R1387:Lcn6 UTSW 2 25,567,149 (GRCm39) missense possibly damaging 0.86
R1500:Lcn6 UTSW 2 25,567,131 (GRCm39) missense probably benign 0.00
R1654:Lcn6 UTSW 2 25,570,787 (GRCm39) splice site probably null
R3005:Lcn6 UTSW 2 25,567,261 (GRCm39) splice site probably null
R4821:Lcn6 UTSW 2 25,570,822 (GRCm39) missense probably damaging 1.00
R5011:Lcn6 UTSW 2 25,567,082 (GRCm39) splice site probably null
R5013:Lcn6 UTSW 2 25,567,082 (GRCm39) splice site probably null
R7779:Lcn6 UTSW 2 25,570,805 (GRCm39) missense probably benign
R8034:Lcn6 UTSW 2 25,566,883 (GRCm39) nonsense probably null
R8558:Lcn6 UTSW 2 25,570,718 (GRCm39) missense probably damaging 1.00
R8697:Lcn6 UTSW 2 25,567,166 (GRCm39) missense probably benign 0.01
R9227:Lcn6 UTSW 2 25,570,107 (GRCm39) missense probably damaging 1.00
R9312:Lcn6 UTSW 2 25,570,074 (GRCm39) missense probably benign 0.23
R9740:Lcn6 UTSW 2 25,571,191 (GRCm39) missense probably benign 0.00
R9749:Lcn6 UTSW 2 25,570,034 (GRCm39) start codon destroyed probably benign
Predicted Primers PCR Primer
(F):5'- GGATAGTGGCTCATCACCTG -3'
(R):5'- AGCAAAGTGGCCTCCTTTC -3'

Sequencing Primer
(F):5'- GATAGTGGCTCATCACCTGAACTG -3'
(R):5'- AAAGTGGCCTCCTTTCCATCAGG -3'
Posted On 2016-04-27