Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Trpm7'

384497

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126824058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 876 (V876A)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

AlphaFold

Q923J1

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028843
AA Change: V876A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: V876A

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103224
AA Change: V876A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: V876A

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Meta Mutation Damage Score

0.4733

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
denounced	UTSW	2	126813021	missense	probably benign	0.00
deposed	UTSW	2	126797498	missense	probably benign	0.01
Summac	UTSW	2	126819963	missense	probably damaging	1.00
Vacated	UTSW	2	126849922	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2067:Trpm7	UTSW	2	126797727	missense	probably damaging	1.00
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
R8674:Trpm7	UTSW	2	126799166	unclassified	probably benign
R8742:Trpm7	UTSW	2	126825549	missense	probably damaging	1.00
R8754:Trpm7	UTSW	2	126822703	missense	probably damaging	1.00
R8842:Trpm7	UTSW	2	126821211	missense	probably benign	0.05
R8850:Trpm7	UTSW	2	126810180	missense	probably benign	0.00
R8881:Trpm7	UTSW	2	126819963	missense	probably damaging	1.00
R8898:Trpm7	UTSW	2	126822741	missense	possibly damaging	0.92
R9339:Trpm7	UTSW	2	126823986	missense	probably benign	0.04
R9428:Trpm7	UTSW	2	126829220	missense	probably damaging	1.00
R9446:Trpm7	UTSW	2	126830265	critical splice acceptor site	probably null
R9568:Trpm7	UTSW	2	126822590	missense	probably benign	0.02
R9647:Trpm7	UTSW	2	126825642	missense	probably damaging	1.00
R9678:Trpm7	UTSW	2	126844370	missense	probably damaging	1.00
R9746:Trpm7	UTSW	2	126822658	missense	possibly damaging	0.47
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCAGATCACGTGTAATGAGTAAATC -3'
(R):5'- GCAAACCTGTTATCTGCCACC -3'

Sequencing Primer
(F):5'- TGAGACAGTTTAACCTCGGC -3'
(R):5'- ACCTGTTATCTGCCACCTAAAC -3'

Posted On

2016-04-27