Incidental Mutation 'R4972:Fcrl5'
ID384501
Institutional Source Beutler Lab
Gene Symbol Fcrl5
Ensembl Gene ENSMUSG00000048031
Gene NameFc receptor-like 5
SynonymsBXMAS1-like protein 2, Fcrh3, mBXMH2
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87435773-87500678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87454650 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 407 (M407V)
Ref Sequence ENSEMBL: ENSMUSP00000141311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049926] [ENSMUST00000166297] [ENSMUST00000178261] [ENSMUST00000193229] [ENSMUST00000194102]
Predicted Effect probably benign
Transcript: ENSMUST00000049926
AA Change: M495V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000050151
Gene: ENSMUSG00000048031
AA Change: M495V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166297
AA Change: M407V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131176
Gene: ENSMUSG00000048031
AA Change: M407V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178261
AA Change: M495V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136046
Gene: ENSMUSG00000048031
AA Change: M495V

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193229
AA Change: M407V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141311
Gene: ENSMUSG00000048031
AA Change: M407V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IGc2 40 100 6.16e-4 SMART
IG_like 125 208 4.41e1 SMART
IGc2 228 292 3.97e-7 SMART
IG_like 322 385 2.94e-1 SMART
transmembrane domain 407 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194102
AA Change: M495V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142210
Gene: ENSMUSG00000048031
AA Change: M495V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 40 113 2.08e-1 SMART
IGc2 128 188 6.16e-4 SMART
IG_like 213 296 4.41e1 SMART
IGc2 316 380 3.97e-7 SMART
IG_like 410 473 2.94e-1 SMART
transmembrane domain 495 517 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin receptor superfamily and the Fc-receptor like family. This gene and several other Fc receptor-like gene members are clustered on the long arm of chromosome 1. The encoded protein is a single-pass type I membrane protein and contains 8 immunoglobulin-like C2-type domains. This gene is implicated in B cell development and lymphomagenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Fcrl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Fcrl5 APN 3 87444291 missense probably damaging 0.96
IGL01868:Fcrl5 APN 3 87443707 missense possibly damaging 0.58
IGL01939:Fcrl5 APN 3 87446299 missense probably damaging 0.99
IGL02817:Fcrl5 APN 3 87435913 missense probably benign 0.35
IGL03106:Fcrl5 APN 3 87435883 unclassified probably null
R0381:Fcrl5 UTSW 3 87446460 missense probably damaging 1.00
R0523:Fcrl5 UTSW 3 87457792 missense possibly damaging 0.72
R0646:Fcrl5 UTSW 3 87442013 missense probably benign 0.00
R1231:Fcrl5 UTSW 3 87442179 missense probably benign 0.13
R1353:Fcrl5 UTSW 3 87448362 missense probably damaging 1.00
R1711:Fcrl5 UTSW 3 87457414 missense possibly damaging 0.61
R1714:Fcrl5 UTSW 3 87446406 missense probably damaging 1.00
R1719:Fcrl5 UTSW 3 87457397 missense probably damaging 0.98
R2084:Fcrl5 UTSW 3 87444230 missense probably benign 0.24
R2358:Fcrl5 UTSW 3 87446419 missense probably damaging 0.99
R2884:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R2885:Fcrl5 UTSW 3 87457391 missense probably damaging 1.00
R3085:Fcrl5 UTSW 3 87446464 missense probably damaging 1.00
R3153:Fcrl5 UTSW 3 87443680 missense probably benign 0.09
R4288:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4289:Fcrl5 UTSW 3 87442224 missense probably benign 0.09
R4614:Fcrl5 UTSW 3 87448426 missense probably damaging 1.00
R4719:Fcrl5 UTSW 3 87444189 missense probably damaging 1.00
R4788:Fcrl5 UTSW 3 87457188 missense probably damaging 1.00
R4920:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R5373:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5374:Fcrl5 UTSW 3 87446391 missense probably benign 0.01
R5963:Fcrl5 UTSW 3 87444173 missense probably damaging 1.00
R5975:Fcrl5 UTSW 3 87442103 missense probably benign 0.00
R6022:Fcrl5 UTSW 3 87455763 missense probably benign 0.42
R6267:Fcrl5 UTSW 3 87448324 missense probably damaging 1.00
R6372:Fcrl5 UTSW 3 87444194 nonsense probably null
R6393:Fcrl5 UTSW 3 87448327 missense probably damaging 1.00
R7088:Fcrl5 UTSW 3 87457834 makesense probably null
R7175:Fcrl5 UTSW 3 87446338 missense probably benign 0.37
R7210:Fcrl5 UTSW 3 87446412 missense possibly damaging 0.85
R7217:Fcrl5 UTSW 3 87443774 missense probably damaging 1.00
R7243:Fcrl5 UTSW 3 87442245 missense probably benign
R7776:Fcrl5 UTSW 3 87444195 missense possibly damaging 0.84
R7813:Fcrl5 UTSW 3 87443623 missense probably benign 0.09
X0054:Fcrl5 UTSW 3 87446299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGGCTTGGTACTCCTGGTC -3'
(R):5'- AACAGGACTTCTGAGGGACC -3'

Sequencing Primer
(F):5'- GGTACTCCTGGTCACAAAGGTTC -3'
(R):5'- ACTTCTGAGGGACCCAGAG -3'
Posted On2016-04-27