Incidental Mutation 'R4972:Col24a1'
ID 384502
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Name collagen, type XXIV, alpha 1
Synonyms 5430404K19Rik
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 145292472-145552011 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 145509684 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1444 (I1444F)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
AlphaFold Q30D77
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: I1444F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: I1444F

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7315:Col24a1 UTSW 3 145431870 missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7371:Col24a1 UTSW 3 145343698 missense probably benign 0.06
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R7921:Col24a1 UTSW 3 145474238 missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
R8430:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145545265 missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145314037 missense probably null
R9056:Col24a1 UTSW 3 145315248 missense probably damaging 0.96
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGGTATACCCATACATTTGAGTT -3'
(R):5'- TGGCCTATGGTGATATTTTGCTCA -3'

Sequencing Primer
(F):5'- CTGGTCTCCAGTGATAGAAGCTC -3'
(R):5'- AGGATGGAGCTTGCACAT -3'
Posted On 2016-04-27