Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Col24a1'

384502

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 145509684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1444 (I1444F)

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably benign
Transcript: ENSMUST00000029848
AA Change: I1444F

PolyPhen 2 Score 0.418 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: I1444F

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Meta Mutation Damage Score

0.0891

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1861:Col24a1	UTSW	3	145537267	critical splice donor site	probably null
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTGGTATACCCATACATTTGAGTT -3'
(R):5'- TGGCCTATGGTGATATTTTGCTCA -3'

Sequencing Primer
(F):5'- CTGGTCTCCAGTGATAGAAGCTC -3'
(R):5'- AGGATGGAGCTTGCACAT -3'

Posted On

2016-04-27