Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Grin3a'

384505

Institutional Source

Beutler Lab

Gene Symbol

Grin3a

Ensembl Gene

ENSMUSG00000039579

Gene Name

glutamate receptor ionotropic, NMDA3A

Synonyms

NR3A, A830097C19Rik, NMDAR-L

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49661611-49845744 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49770484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 763 (N763D)

Ref Sequence

ENSEMBL: ENSMUSP00000091381 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]

AlphaFold

A2AIR5

Predicted Effect

probably damaging
Transcript: ENSMUST00000076674
AA Change: N763D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: N763D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	161	181	N/A	INTRINSIC
Lig_chan-Glu_bd	557	622	9.62e-22	SMART
PBPe	565	910	1.43e-73	SMART
transmembrane domain	934	956	N/A	INTRINSIC
coiled coil region	1063	1105	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093859
AA Change: N763D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: N763D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	161	181	N/A	INTRINSIC
Lig_chan-Glu_bd	557	622	9.62e-22	SMART
PBPe	565	910	1.43e-73	SMART
transmembrane domain	934	956	N/A	INTRINSIC
coiled coil region	1083	1125	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131797

Meta Mutation Damage Score

0.6524

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Grin3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Grin3a	APN	4	49770589	missense	probably damaging	1.00
IGL01541:Grin3a	APN	4	49792533	missense	probably damaging	0.98
IGL01886:Grin3a	APN	4	49702814	missense	probably damaging	1.00
IGL02133:Grin3a	APN	4	49792946	nonsense	probably null
IGL02367:Grin3a	APN	4	49702805	missense	probably damaging	1.00
IGL02481:Grin3a	APN	4	49702868	missense	probably damaging	1.00
IGL02830:Grin3a	APN	4	49702787	missense	possibly damaging	0.94
IGL02945:Grin3a	APN	4	49792971	missense	possibly damaging	0.86
IGL03174:Grin3a	APN	4	49771107	missense	probably damaging	1.00
R0266:Grin3a	UTSW	4	49665501	nonsense	probably null
R0597:Grin3a	UTSW	4	49665351	missense	probably damaging	1.00
R0849:Grin3a	UTSW	4	49665501	nonsense	probably null
R1448:Grin3a	UTSW	4	49702804	missense	probably damaging	1.00
R1640:Grin3a	UTSW	4	49844721	missense	probably benign
R1751:Grin3a	UTSW	4	49844423	missense	probably damaging	1.00
R1767:Grin3a	UTSW	4	49844423	missense	probably damaging	1.00
R1858:Grin3a	UTSW	4	49792437	missense	probably benign	0.01
R1860:Grin3a	UTSW	4	49665309	missense	possibly damaging	0.95
R1924:Grin3a	UTSW	4	49844988	missense	possibly damaging	0.95
R2035:Grin3a	UTSW	4	49771336	missense	probably damaging	1.00
R2108:Grin3a	UTSW	4	49665510	missense	possibly damaging	0.91
R2307:Grin3a	UTSW	4	49793033	critical splice acceptor site	probably null
R3082:Grin3a	UTSW	4	49665243	missense	probably benign	0.00
R3083:Grin3a	UTSW	4	49665243	missense	probably benign	0.00
R3430:Grin3a	UTSW	4	49792534	missense	probably benign	0.01
R3695:Grin3a	UTSW	4	49792704	missense	possibly damaging	0.81
R3932:Grin3a	UTSW	4	49672472	critical splice donor site	probably null
R4559:Grin3a	UTSW	4	49844555	missense	probably damaging	1.00
R4982:Grin3a	UTSW	4	49665512	missense	probably benign	0.03
R5385:Grin3a	UTSW	4	49719313	missense	probably damaging	1.00
R5423:Grin3a	UTSW	4	49770376	intron	probably benign
R5478:Grin3a	UTSW	4	49792481	missense	probably benign	0.00
R5634:Grin3a	UTSW	4	49792843	missense	probably damaging	1.00
R5790:Grin3a	UTSW	4	49792717	missense	probably damaging	1.00
R5976:Grin3a	UTSW	4	49792602	missense	probably damaging	1.00
R6271:Grin3a	UTSW	4	49792516	missense	probably benign	0.00
R6451:Grin3a	UTSW	4	49844969	missense	probably damaging	1.00
R6538:Grin3a	UTSW	4	49770856	missense	probably damaging	1.00
R6629:Grin3a	UTSW	4	49844991	missense	probably damaging	1.00
R7217:Grin3a	UTSW	4	49770741	missense	possibly damaging	0.81
R7337:Grin3a	UTSW	4	49702762	missense	probably damaging	1.00
R7338:Grin3a	UTSW	4	49771238	missense	probably benign
R7477:Grin3a	UTSW	4	49719278	missense	probably damaging	1.00
R8090:Grin3a	UTSW	4	49714224	missense	probably damaging	1.00
R8313:Grin3a	UTSW	4	49665599	missense	probably benign
R8559:Grin3a	UTSW	4	49770555	missense	probably damaging	1.00
R9103:Grin3a	UTSW	4	49771179	missense	probably damaging	0.99
R9662:Grin3a	UTSW	4	49792432	missense	possibly damaging	0.79
R9736:Grin3a	UTSW	4	49672472	critical splice donor site	probably null
R9760:Grin3a	UTSW	4	49714213	missense	probably damaging	1.00
Z1176:Grin3a	UTSW	4	49770622	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGTGTACCTGCTTATATGTACAC -3'
(R):5'- AAGAGCCCCTTTGGTATGAC -3'

Sequencing Primer
(F):5'- AACTCTACCTCTGAAGTGCTGGG -3'
(R):5'- GAGCCCCTTTGGTATGACTCCTAAAG -3'

Posted On

2016-04-27