Incidental Mutation 'R4972:Grin3a'
ID 384505
Institutional Source Beutler Lab
Gene Symbol Grin3a
Ensembl Gene ENSMUSG00000039579
Gene Name glutamate receptor ionotropic, NMDA3A
Synonyms NR3A, A830097C19Rik, NMDAR-L
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 49661611-49845744 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 49770484 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 763 (N763D)
Ref Sequence ENSEMBL: ENSMUSP00000091381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076674] [ENSMUST00000093859]
AlphaFold A2AIR5
Predicted Effect probably damaging
Transcript: ENSMUST00000076674
AA Change: N763D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075970
Gene: ENSMUSG00000039579
AA Change: N763D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1063 1105 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000093859
AA Change: N763D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091381
Gene: ENSMUSG00000039579
AA Change: N763D

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 161 181 N/A INTRINSIC
Lig_chan-Glu_bd 557 622 9.62e-22 SMART
PBPe 565 910 1.43e-73 SMART
transmembrane domain 934 956 N/A INTRINSIC
coiled coil region 1083 1125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131797
Meta Mutation Damage Score 0.6524 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptors, which belong to the superfamily of glutamate-regulated ion channels, and function in physiological and pathological processes in the central nervous system. This subunit shows greater than 90% identity to the corresponding subunit in rat. Studies in the knockout mouse deficient in this subunit suggest that this gene may be involved in the development of synaptic elements by modulating NMDA receptor activity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display increased current densities in some cerebrocortical neurons of the brain, increased levels of prepulse inhibition, and altered dendritic spine morphology. Otherwise, they display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Grin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Grin3a APN 4 49770589 missense probably damaging 1.00
IGL01541:Grin3a APN 4 49792533 missense probably damaging 0.98
IGL01886:Grin3a APN 4 49702814 missense probably damaging 1.00
IGL02133:Grin3a APN 4 49792946 nonsense probably null
IGL02367:Grin3a APN 4 49702805 missense probably damaging 1.00
IGL02481:Grin3a APN 4 49702868 missense probably damaging 1.00
IGL02830:Grin3a APN 4 49702787 missense possibly damaging 0.94
IGL02945:Grin3a APN 4 49792971 missense possibly damaging 0.86
IGL03174:Grin3a APN 4 49771107 missense probably damaging 1.00
R0266:Grin3a UTSW 4 49665501 nonsense probably null
R0597:Grin3a UTSW 4 49665351 missense probably damaging 1.00
R0849:Grin3a UTSW 4 49665501 nonsense probably null
R1448:Grin3a UTSW 4 49702804 missense probably damaging 1.00
R1640:Grin3a UTSW 4 49844721 missense probably benign
R1751:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1767:Grin3a UTSW 4 49844423 missense probably damaging 1.00
R1858:Grin3a UTSW 4 49792437 missense probably benign 0.01
R1860:Grin3a UTSW 4 49665309 missense possibly damaging 0.95
R1924:Grin3a UTSW 4 49844988 missense possibly damaging 0.95
R2035:Grin3a UTSW 4 49771336 missense probably damaging 1.00
R2108:Grin3a UTSW 4 49665510 missense possibly damaging 0.91
R2307:Grin3a UTSW 4 49793033 critical splice acceptor site probably null
R3082:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3083:Grin3a UTSW 4 49665243 missense probably benign 0.00
R3430:Grin3a UTSW 4 49792534 missense probably benign 0.01
R3695:Grin3a UTSW 4 49792704 missense possibly damaging 0.81
R3932:Grin3a UTSW 4 49672472 critical splice donor site probably null
R4559:Grin3a UTSW 4 49844555 missense probably damaging 1.00
R4982:Grin3a UTSW 4 49665512 missense probably benign 0.03
R5385:Grin3a UTSW 4 49719313 missense probably damaging 1.00
R5423:Grin3a UTSW 4 49770376 intron probably benign
R5478:Grin3a UTSW 4 49792481 missense probably benign 0.00
R5634:Grin3a UTSW 4 49792843 missense probably damaging 1.00
R5790:Grin3a UTSW 4 49792717 missense probably damaging 1.00
R5976:Grin3a UTSW 4 49792602 missense probably damaging 1.00
R6271:Grin3a UTSW 4 49792516 missense probably benign 0.00
R6451:Grin3a UTSW 4 49844969 missense probably damaging 1.00
R6538:Grin3a UTSW 4 49770856 missense probably damaging 1.00
R6629:Grin3a UTSW 4 49844991 missense probably damaging 1.00
R7217:Grin3a UTSW 4 49770741 missense possibly damaging 0.81
R7337:Grin3a UTSW 4 49702762 missense probably damaging 1.00
R7338:Grin3a UTSW 4 49771238 missense probably benign
R7477:Grin3a UTSW 4 49719278 missense probably damaging 1.00
R8090:Grin3a UTSW 4 49714224 missense probably damaging 1.00
R8313:Grin3a UTSW 4 49665599 missense probably benign
R8559:Grin3a UTSW 4 49770555 missense probably damaging 1.00
R9103:Grin3a UTSW 4 49771179 missense probably damaging 0.99
Z1176:Grin3a UTSW 4 49770622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTGTACCTGCTTATATGTACAC -3'
(R):5'- AAGAGCCCCTTTGGTATGAC -3'

Sequencing Primer
(F):5'- AACTCTACCTCTGAAGTGCTGGG -3'
(R):5'- GAGCCCCTTTGGTATGACTCCTAAAG -3'
Posted On 2016-04-27