Incidental Mutation 'R4972:Zscan20'
ID384509
Institutional Source Beutler Lab
Gene Symbol Zscan20
Ensembl Gene ENSMUSG00000061894
Gene Namezinc finger and SCAN domains 20
SynonymsZfp31
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location128583539-128610098 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128592359 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 183 (P183S)
Ref Sequence ENSEMBL: ENSMUSP00000119338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097877] [ENSMUST00000135309]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084276
Predicted Effect probably benign
Transcript: ENSMUST00000097877
AA Change: P183S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095487
Gene: ENSMUSG00000061894
AA Change: P183S

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 275 284 N/A INTRINSIC
SANT 314 378 8.04e-1 SMART
SANT 475 539 4.85e-3 SMART
ZnF_C2H2 725 747 2.61e1 SMART
ZnF_C2H2 753 775 9.88e-5 SMART
ZnF_C2H2 781 803 1.12e-3 SMART
ZnF_C2H2 862 884 3.21e-4 SMART
ZnF_C2H2 890 912 1.04e-3 SMART
ZnF_C2H2 918 940 1.56e-2 SMART
ZnF_C2H2 946 968 2.84e-5 SMART
ZnF_C2H2 974 996 4.54e-4 SMART
ZnF_C2H2 1002 1024 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135309
AA Change: P183S

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119338
Gene: ENSMUSG00000061894
AA Change: P183S

DomainStartEndE-ValueType
SCAN 41 147 1.31e-54 SMART
low complexity region 279 293 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Other mutations in Zscan20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Zscan20 APN 4 128586635 missense probably damaging 0.99
IGL01454:Zscan20 APN 4 128589541 missense probably benign 0.01
IGL01934:Zscan20 APN 4 128592484 missense possibly damaging 0.94
IGL02288:Zscan20 APN 4 128586643 missense probably damaging 1.00
IGL02336:Zscan20 APN 4 128585794 missense probably damaging 1.00
IGL02385:Zscan20 APN 4 128604599 missense possibly damaging 0.66
IGL02437:Zscan20 APN 4 128588417 missense probably damaging 1.00
IGL02450:Zscan20 APN 4 128586657 missense probably damaging 0.99
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0034:Zscan20 UTSW 4 128585662 missense probably damaging 0.96
R0070:Zscan20 UTSW 4 128585882 missense possibly damaging 0.73
R0142:Zscan20 UTSW 4 128585837 missense probably benign 0.38
R0496:Zscan20 UTSW 4 128591889 missense probably benign 0.42
R0567:Zscan20 UTSW 4 128589450 critical splice donor site probably null
R1333:Zscan20 UTSW 4 128588096 missense possibly damaging 0.61
R1716:Zscan20 UTSW 4 128586541 missense probably damaging 0.96
R2302:Zscan20 UTSW 4 128588264 missense probably damaging 1.00
R3870:Zscan20 UTSW 4 128586425 missense probably damaging 1.00
R4611:Zscan20 UTSW 4 128588106 missense probably benign 0.00
R4884:Zscan20 UTSW 4 128588165 missense possibly damaging 0.56
R5033:Zscan20 UTSW 4 128586128 missense probably benign 0.01
R5160:Zscan20 UTSW 4 128592482 missense possibly damaging 0.69
R5182:Zscan20 UTSW 4 128586711 missense possibly damaging 0.71
R5214:Zscan20 UTSW 4 128588316 missense probably benign 0.00
R5345:Zscan20 UTSW 4 128588121 missense probably benign 0.04
R5863:Zscan20 UTSW 4 128586348 nonsense probably null
R6217:Zscan20 UTSW 4 128604534 missense probably damaging 1.00
R6597:Zscan20 UTSW 4 128585746 missense probably damaging 0.96
R6751:Zscan20 UTSW 4 128585875 missense probably damaging 1.00
R6852:Zscan20 UTSW 4 128589722 missense probably damaging 1.00
R7172:Zscan20 UTSW 4 128585676 nonsense probably null
R7338:Zscan20 UTSW 4 128588150 missense probably benign
R7805:Zscan20 UTSW 4 128585806 missense probably damaging 1.00
R8063:Zscan20 UTSW 4 128586235 missense probably benign 0.01
R8244:Zscan20 UTSW 4 128585966 missense probably benign 0.32
R8421:Zscan20 UTSW 4 128585827 missense probably damaging 1.00
R8752:Zscan20 UTSW 4 128585687 missense probably damaging 1.00
R8939:Zscan20 UTSW 4 128604522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACCTTTGGCTCAATAACAGC -3'
(R):5'- TGGAACACGTTCACACTCAAGG -3'

Sequencing Primer
(F):5'- TTTGGCTCAATAACAGCATCCATC -3'
(R):5'- AGGTAACAGTCCTGTCCCATTGAG -3'
Posted On2016-04-27