Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Pde6b'

384512

Institutional Source

Beutler Lab

Gene Symbol

Pde6b

Ensembl Gene

ENSMUSG00000029491

Gene Name

phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide

Synonyms

rd10, Pdeb, rd, rd1, r

MMRRC Submission

042567-MU

Accession Numbers

Genbank: NM_008806; MGI: 97525

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108388391-108432397 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108425264 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 500 (D500G)

Ref Sequence

ENSEMBL: ENSMUSP00000031456 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031456]

AlphaFold

P23440

Predicted Effect

probably benign
Transcript: ENSMUST00000031456
AA Change: D500G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: D500G

Domain	Start	End	E-Value	Type
GAF	71	230	1.29e-27	SMART
GAF	252	439	5.76e-25	SMART
Blast:HDc	484	538	1e-24	BLAST
HDc	554	732	1.25e-9	SMART
Blast:HDc	757	792	8e-13	BLAST
low complexity region	813	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134865

Meta Mutation Damage Score

0.0703

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Pde6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00534:Pde6b	APN	5	108426571	splice site	probably benign
IGL01071:Pde6b	APN	5	108419715	nonsense	probably null
IGL01335:Pde6b	APN	5	108423513	missense	probably benign	0.03
IGL01611:Pde6b	APN	5	108403396	missense	possibly damaging	0.90
IGL01881:Pde6b	APN	5	108421500	missense	probably benign	0.01
IGL01941:Pde6b	APN	5	108423036	missense	probably benign	0.11
IGL02616:Pde6b	APN	5	108431541	missense	probably benign	0.05
IGL02657:Pde6b	APN	5	108420276	splice site	probably benign
IGL03217:Pde6b	APN	5	108419566	missense	probably damaging	1.00
Bemr28	UTSW	5		unclassified
D4043:Pde6b	UTSW	5	108425356	nonsense	probably null
N/A:Pde6b	UTSW	5	108429103	unclassified	probably benign
PIT4362001:Pde6b	UTSW	5	108423585	critical splice donor site	probably null
PIT4581001:Pde6b	UTSW	5	108428508	missense	probably benign	0.01
R0940:Pde6b	UTSW	5	108420337	missense	possibly damaging	0.95
R0963:Pde6b	UTSW	5	108430668	missense	probably benign
R1738:Pde6b	UTSW	5	108430559	nonsense	probably null
R1753:Pde6b	UTSW	5	108388691	nonsense	probably null
R1801:Pde6b	UTSW	5	108427847	missense	possibly damaging	0.51
R1913:Pde6b	UTSW	5	108427190	missense	probably benign	0.05
R2131:Pde6b	UTSW	5	108428203	missense	probably damaging	1.00
R2282:Pde6b	UTSW	5	108423586	splice site	probably null
R3713:Pde6b	UTSW	5	108423062	missense	probably damaging	1.00
R4385:Pde6b	UTSW	5	108427642	missense	probably benign	0.08
R4562:Pde6b	UTSW	5	108403368	missense	probably benign	0.23
R4582:Pde6b	UTSW	5	108425231	critical splice acceptor site	probably null
R4939:Pde6b	UTSW	5	108421497	missense	probably benign	0.01
R4950:Pde6b	UTSW	5	108430703	missense	probably benign	0.16
R4983:Pde6b	UTSW	5	108425330	missense	probably benign	0.21
R5056:Pde6b	UTSW	5	108423491	nonsense	probably null
R5514:Pde6b	UTSW	5	108423451	missense	probably benign	0.06
R5528:Pde6b	UTSW	5	108423558	missense	probably benign	0.04
R5937:Pde6b	UTSW	5	108424327	missense	probably benign	0.00
R6556:Pde6b	UTSW	5	108421501	missense	possibly damaging	0.56
R6826:Pde6b	UTSW	5	108430592	nonsense	probably null
R6884:Pde6b	UTSW	5	108388708	missense	probably damaging	0.99
R7213:Pde6b	UTSW	5	108404090	missense	probably damaging	1.00
R7444:Pde6b	UTSW	5	108427142	nonsense	probably null
R7690:Pde6b	UTSW	5	108419518	missense	probably damaging	1.00
R7909:Pde6b	UTSW	5	108403422	missense	probably benign	0.01
R7937:Pde6b	UTSW	5	108419773	critical splice donor site	probably null
R8049:Pde6b	UTSW	5	108425252	missense	probably benign	0.04
R8087:Pde6b	UTSW	5	108388462	missense	probably benign	0.00
R8698:Pde6b	UTSW	5	108428239	missense	possibly damaging	0.87
R8822:Pde6b	UTSW	5	108403462	missense	probably benign	0.00
R8985:Pde6b	UTSW	5	108430637	missense	probably benign	0.02
R9016:Pde6b	UTSW	5	108388726	missense	possibly damaging	0.88
R9292:Pde6b	UTSW	5	108388885	missense	probably benign	0.00
R9323:Pde6b	UTSW	5	108403432	missense	probably damaging	1.00
R9414:Pde6b	UTSW	5	108419726	missense	possibly damaging	0.82
R9486:Pde6b	UTSW	5	108403375	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TTACCTGGTGCAAGGAAACAG -3'
(R):5'- ACATATACACTTCACCTCTTGGGG -3'

Sequencing Primer
(F):5'- CAGTAGGATAAGATAAACAGTGGCC -3'
(R):5'- GGGACCTGTAACCTTTACCAC -3'

Posted On

2016-04-27