Incidental Mutation 'R4972:Iscu'
ID 384513
Institutional Source Beutler Lab
Gene Symbol Iscu
Ensembl Gene ENSMUSG00000025825
Gene Name iron-sulfur cluster assembly enzyme
Synonyms 2310020H20Rik, Nifun
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock # R4972 (G1)
Quality Score 196
Status Validated
Chromosome 5
Chromosomal Location 113772748-113778288 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 113776976 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019118] [ENSMUST00000026937] [ENSMUST00000112311] [ENSMUST00000112312] [ENSMUST00000123616] [ENSMUST00000145592] [ENSMUST00000145778]
AlphaFold Q9D7P6
Predicted Effect probably benign
Transcript: ENSMUST00000019118
SMART Domains Protein: ENSMUSP00000019118
Gene: ENSMUSG00000018974

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 11 33 N/A INTRINSIC
low complexity region 42 50 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
HAT 127 159 1.76e1 SMART
HAT 165 196 4.82e-1 SMART
HAT 202 238 1.53e-3 SMART
low complexity region 269 281 N/A INTRINSIC
HAT 325 357 1.78e-4 SMART
HAT 360 392 7.83e-1 SMART
HAT 395 431 7.56e0 SMART
HAT 488 521 7.31e-1 SMART
coiled coil region 554 619 N/A INTRINSIC
low complexity region 626 640 N/A INTRINSIC
RRM 705 778 1.87e-14 SMART
RRM 802 874 3.2e-22 SMART
Pfam:LSM_int_assoc 877 937 3.1e-28 PFAM
Pfam:Lsm_interact 944 961 2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026937
SMART Domains Protein: ENSMUSP00000026937
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 161 3.9e-57 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112311
AA Change: L183Q
SMART Domains Protein: ENSMUSP00000107930
Gene: ENSMUSG00000025825
AA Change: L183Q

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 1.1e-51 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000112312
AA Change: L183Q
SMART Domains Protein: ENSMUSP00000107931
Gene: ENSMUSG00000025825
AA Change: L183Q

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:NifU_N 35 149 3.4e-49 PFAM
low complexity region 170 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123616
SMART Domains Protein: ENSMUSP00000117973
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134881
Predicted Effect probably benign
Transcript: ENSMUST00000145592
SMART Domains Protein: ENSMUSP00000123237
Gene: ENSMUSG00000025825

DomainStartEndE-ValueType
Pfam:NifU_N 32 136 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145778
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Iscu
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1974:Iscu UTSW 5 113777018 intron probably benign
R5210:Iscu UTSW 5 113776973 nonsense probably null
R6805:Iscu UTSW 5 113775243 missense probably damaging 1.00
R7039:Iscu UTSW 5 113776772 missense possibly damaging 0.95
R7235:Iscu UTSW 5 113776882 missense probably benign 0.26
R7922:Iscu UTSW 5 113774282 missense probably damaging 0.99
R7922:Iscu UTSW 5 113774349 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAACTGTACTTTACCCCGCC -3'
(R):5'- ATACCGAGGGTGAGGCTATG -3'

Sequencing Primer
(F):5'- CACTTCAGGTGGAGGAAGCC -3'
(R):5'- GTGAGGCTATGGGCGAAG -3'
Posted On 2016-04-27