Incidental Mutation 'R4972:C2cd5'
ID384516
Institutional Source Beutler Lab
Gene Symbol C2cd5
Ensembl Gene ENSMUSG00000030279
Gene NameC2 calcium-dependent domain containing 5
Synonyms5730419I09Rik, C030008B15Rik, CDP138
MMRRC Submission 042567-MU
Accession Numbers

Genbank: NM_001109688; NM_029081; NM_029897

Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R4972 (G1)
Quality Score187
Status Validated
Chromosome6
Chromosomal Location143010920-143100141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 143013224 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1003 (M1003K)
Ref Sequence ENSEMBL: ENSMUSP00000145425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087485] [ENSMUST00000111758] [ENSMUST00000171349] [ENSMUST00000203187] [ENSMUST00000203673] [ENSMUST00000204655] [ENSMUST00000205119]
Predicted Effect probably damaging
Transcript: ENSMUST00000087485
AA Change: M941K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000084758
Gene: ENSMUSG00000030279
AA Change: M941K

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 350 359 N/A INTRINSIC
internal_repeat_1 381 453 3.98e-5 PROSPERO
low complexity region 637 653 N/A INTRINSIC
internal_repeat_1 909 984 3.98e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000111758
AA Change: M941K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107388
Gene: ENSMUSG00000030279
AA Change: M941K

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000171349
AA Change: M950K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127834
Gene: ENSMUSG00000030279
AA Change: M950K

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000203187
AA Change: M967K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145373
Gene: ENSMUSG00000030279
AA Change: M967K

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.3e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 935 1010 1.3e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000203673
AA Change: M1003K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145425
Gene: ENSMUSG00000030279
AA Change: M1003K

DomainStartEndE-ValueType
C2 4 105 7.3e-18 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 309 320 N/A INTRINSIC
low complexity region 361 370 N/A INTRINSIC
internal_repeat_1 392 464 4.65e-5 PROSPERO
low complexity region 648 664 N/A INTRINSIC
internal_repeat_1 971 1046 4.65e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204635
Predicted Effect probably damaging
Transcript: ENSMUST00000204655
AA Change: M950K

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145019
Gene: ENSMUSG00000030279
AA Change: M950K

DomainStartEndE-ValueType
C2 4 105 1.07e-15 SMART
Blast:C2 127 177 1e-24 BLAST
low complexity region 290 317 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
internal_repeat_1 390 462 1.16e-5 PROSPERO
low complexity region 646 662 N/A INTRINSIC
internal_repeat_1 918 993 1.16e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000205119
SMART Domains Protein: ENSMUSP00000145397
Gene: ENSMUSG00000030279

DomainStartEndE-ValueType
Pfam:C2 3 70 5.4e-14 PFAM
Meta Mutation Damage Score 0.3156 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in C2cd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:C2cd5 APN 6 143017945 missense probably null 0.99
IGL01065:C2cd5 APN 6 143078279 missense probably damaging 0.98
IGL01595:C2cd5 APN 6 143018022 missense probably damaging 1.00
IGL01654:C2cd5 APN 6 143081407 missense probably benign 0.06
IGL01917:C2cd5 APN 6 143072596 missense probably benign
IGL01966:C2cd5 APN 6 143012041 nonsense probably null
IGL02417:C2cd5 APN 6 143041492 missense probably damaging 1.00
IGL02616:C2cd5 APN 6 143035111 missense probably benign 0.10
IGL02745:C2cd5 APN 6 143041530 missense probably benign 0.17
IGL02819:C2cd5 APN 6 143083220 missense probably benign 0.33
IGL02926:C2cd5 APN 6 143031237 splice site probably benign
IGL02969:C2cd5 APN 6 143079943 missense probably damaging 1.00
IGL03072:C2cd5 APN 6 143079883 missense possibly damaging 0.89
IGL03226:C2cd5 APN 6 143072566 missense possibly damaging 0.86
D605:C2cd5 UTSW 6 143029660 missense probably benign 0.00
R0385:C2cd5 UTSW 6 143041490 missense probably damaging 1.00
R0497:C2cd5 UTSW 6 143012093 missense probably benign 0.00
R0644:C2cd5 UTSW 6 143013224 missense probably damaging 0.99
R0723:C2cd5 UTSW 6 143041555 splice site probably benign
R0740:C2cd5 UTSW 6 143036263 missense probably damaging 1.00
R1395:C2cd5 UTSW 6 143061738 splice site probably benign
R1475:C2cd5 UTSW 6 143072572 missense possibly damaging 0.47
R1494:C2cd5 UTSW 6 143041346 splice site probably benign
R1645:C2cd5 UTSW 6 143050126 missense probably damaging 1.00
R1928:C2cd5 UTSW 6 143013230 missense probably damaging 1.00
R2253:C2cd5 UTSW 6 143036316 nonsense probably null
R3934:C2cd5 UTSW 6 143041380 missense possibly damaging 0.96
R4065:C2cd5 UTSW 6 143073671 missense probably benign
R4654:C2cd5 UTSW 6 143030184 missense probably benign 0.00
R4691:C2cd5 UTSW 6 143030148 missense possibly damaging 0.47
R5302:C2cd5 UTSW 6 143073756 missense probably benign 0.02
R5362:C2cd5 UTSW 6 143083243 missense probably damaging 1.00
R5604:C2cd5 UTSW 6 143012021 missense probably benign 0.44
R6139:C2cd5 UTSW 6 143035058 missense probably damaging 0.97
R6165:C2cd5 UTSW 6 143050228 missense possibly damaging 0.58
R6567:C2cd5 UTSW 6 143031248 missense possibly damaging 0.86
R6600:C2cd5 UTSW 6 143079976 missense probably damaging 0.99
R6821:C2cd5 UTSW 6 143017986 missense probably damaging 1.00
R6838:C2cd5 UTSW 6 143029638 missense possibly damaging 0.68
R7153:C2cd5 UTSW 6 143019409 missense probably benign 0.04
R7689:C2cd5 UTSW 6 143050225 nonsense probably null
R8027:C2cd5 UTSW 6 143078320 missense possibly damaging 0.95
X0013:C2cd5 UTSW 6 143067082 missense probably damaging 0.99
Z1177:C2cd5 UTSW 6 143029206 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGTGAGGTGTAACAGCAC -3'
(R):5'- TTAAGGTAACCTGGAATGTGCAC -3'

Sequencing Primer
(F):5'- GTGTAACAGCACCTGAGTGG -3'
(R):5'- AACCTGGAATGTGCACTGTGTC -3'
Posted On2016-04-27