Incidental Mutation 'R4972:Cep89'
ID 384518
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Name centrosomal protein 89
Synonyms Ccdc123, 2610507L03Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.177) question?
Stock # R4972 (G1)
Quality Score 178
Status Not validated
Chromosome 7
Chromosomal Location 35096460-35138114 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 35131977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 637 (L637R)
Ref Sequence ENSEMBL: ENSMUSP00000078383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
AlphaFold Q9CZX2
Predicted Effect probably damaging
Transcript: ENSMUST00000079414
AA Change: L637R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072
AA Change: L637R

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140418
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148166
Predicted Effect probably benign
Transcript: ENSMUST00000150421
SMART Domains Protein: ENSMUSP00000121422
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
coiled coil region 77 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35,105,132 (GRCm39) missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35,120,325 (GRCm39) missense probably damaging 1.00
IGL02001:Cep89 APN 7 35,102,432 (GRCm39) splice site probably benign
IGL02141:Cep89 APN 7 35,120,349 (GRCm39) missense probably damaging 1.00
IGL02468:Cep89 APN 7 35,102,577 (GRCm39) missense probably benign 0.35
IGL02507:Cep89 APN 7 35,134,990 (GRCm39) missense probably damaging 1.00
IGL02612:Cep89 APN 7 35,124,080 (GRCm39) critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35,124,078 (GRCm39) intron probably benign
IGL03396:Cep89 APN 7 35,128,603 (GRCm39) missense probably benign 0.05
3-1:Cep89 UTSW 7 35,124,147 (GRCm39) missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35,109,066 (GRCm39) utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35,109,066 (GRCm39) utr 3 prime probably benign
K2124:Cep89 UTSW 7 35,120,397 (GRCm39) splice site probably benign
R0127:Cep89 UTSW 7 35,127,687 (GRCm39) missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35,115,827 (GRCm39) unclassified probably benign
R0609:Cep89 UTSW 7 35,134,955 (GRCm39) missense probably damaging 1.00
R1442:Cep89 UTSW 7 35,117,636 (GRCm39) splice site probably benign
R1468:Cep89 UTSW 7 35,120,388 (GRCm39) splice site probably null
R1468:Cep89 UTSW 7 35,120,388 (GRCm39) splice site probably null
R1661:Cep89 UTSW 7 35,117,105 (GRCm39) missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35,137,808 (GRCm39) missense probably damaging 1.00
R4414:Cep89 UTSW 7 35,115,822 (GRCm39) unclassified probably benign
R4700:Cep89 UTSW 7 35,137,862 (GRCm39) missense probably benign 0.05
R4963:Cep89 UTSW 7 35,102,577 (GRCm39) missense probably benign 0.35
R4968:Cep89 UTSW 7 35,109,055 (GRCm39) missense possibly damaging 0.90
R5578:Cep89 UTSW 7 35,109,067 (GRCm39) unclassified probably benign
R5767:Cep89 UTSW 7 35,117,070 (GRCm39) missense probably damaging 1.00
R5809:Cep89 UTSW 7 35,117,151 (GRCm39) missense probably damaging 0.97
R5890:Cep89 UTSW 7 35,128,587 (GRCm39) missense probably damaging 0.99
R6290:Cep89 UTSW 7 35,119,688 (GRCm39) missense probably damaging 1.00
R6361:Cep89 UTSW 7 35,097,472 (GRCm39) missense probably damaging 1.00
R6627:Cep89 UTSW 7 35,127,172 (GRCm39) missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35,137,888 (GRCm39) missense probably benign 0.03
R7340:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7341:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7347:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7348:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7365:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7366:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7394:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7399:Cep89 UTSW 7 35,137,803 (GRCm39) missense probably damaging 1.00
R7422:Cep89 UTSW 7 35,127,672 (GRCm39) missense probably damaging 1.00
R7792:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7793:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R7819:Cep89 UTSW 7 35,131,968 (GRCm39) missense probably benign 0.07
R7860:Cep89 UTSW 7 35,113,570 (GRCm39) missense possibly damaging 0.63
R7899:Cep89 UTSW 7 35,129,353 (GRCm39) missense probably damaging 0.97
R8336:Cep89 UTSW 7 35,127,141 (GRCm39) nonsense probably null
R8669:Cep89 UTSW 7 35,128,602 (GRCm39) missense probably benign 0.04
R8974:Cep89 UTSW 7 35,097,493 (GRCm39) missense probably damaging 0.99
R9580:Cep89 UTSW 7 35,102,538 (GRCm39) missense possibly damaging 0.63
V7732:Cep89 UTSW 7 35,102,523 (GRCm39) missense probably damaging 1.00
Z1177:Cep89 UTSW 7 35,096,506 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGTCCAAGCTCTGCCTACAG -3'
(R):5'- TTTAAGGAGGTACAAGGTGCTGC -3'

Sequencing Primer
(F):5'- TGCCTACAGCCCCTCAG -3'
(R):5'- CTTGCATGGGCCAGTCATG -3'
Posted On 2016-04-27