Incidental Mutation 'R4972:Coq7'
ID 384523
Institutional Source Beutler Lab
Gene Symbol Coq7
Ensembl Gene ENSMUSG00000030652
Gene Name demethyl-Q 7
Synonyms clk-1
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 118509659-118533356 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118510117 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 236 (V236A)
Ref Sequence ENSEMBL: ENSMUSP00000095695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098090]
AlphaFold P97478
Predicted Effect unknown
Transcript: ENSMUST00000098090
AA Change: V236A
SMART Domains Protein: ENSMUSP00000095695
Gene: ENSMUSG00000030652
AA Change: V236A

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
Pfam:COQ7 48 210 5.9e-69 PFAM
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to a mitochondrial di-iron containing hydroxylase in Saccharomyces cerevisiae that is involved with ubiquinone biosynthesis. Mutations in the yeast gene lead to slower development and longer life span. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for null mutations in this gene are embryonic lethal during mid-gestation with aborted neurogenesis and abnormal mitochondria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Coq7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Coq7 APN 7 118525304 missense probably damaging 0.98
R0309:Coq7 UTSW 7 118529717 missense possibly damaging 0.92
R0628:Coq7 UTSW 7 118529644 missense probably damaging 1.00
R1459:Coq7 UTSW 7 118510037 missense unknown
R1535:Coq7 UTSW 7 118529674 missense possibly damaging 0.48
R1612:Coq7 UTSW 7 118509911 missense unknown
R2519:Coq7 UTSW 7 118510148 missense unknown
R4095:Coq7 UTSW 7 118527478 critical splice acceptor site probably null
R4516:Coq7 UTSW 7 118509907 missense unknown
R5183:Coq7 UTSW 7 118528267 intron probably benign
R5579:Coq7 UTSW 7 118517335 missense unknown
R5619:Coq7 UTSW 7 118527486 splice site probably benign
R5789:Coq7 UTSW 7 118529706 missense possibly damaging 0.50
R6530:Coq7 UTSW 7 118525335 missense probably benign 0.01
R6911:Coq7 UTSW 7 118510162 missense unknown
R7212:Coq7 UTSW 7 118510048 missense unknown
R7248:Coq7 UTSW 7 118529674 missense probably benign 0.42
R7361:Coq7 UTSW 7 118529575 missense probably benign 0.15
R7781:Coq7 UTSW 7 118525888 missense probably damaging 1.00
R8039:Coq7 UTSW 7 118533246 missense possibly damaging 0.93
R8796:Coq7 UTSW 7 118527417 missense probably damaging 0.96
R9166:Coq7 UTSW 7 118510142 missense unknown
RF001:Coq7 UTSW 7 118533182 missense probably benign 0.05
Z1177:Coq7 UTSW 7 118510149 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGTGGGGCTTGTTCATCCC -3'
(R):5'- GAAATGCCTCTGTCTTCTGAGATAAG -3'

Sequencing Primer
(F):5'- GTTCATCCCTCCCATGCAGAAC -3'
(R):5'- TCCATTATCATCAAGGTGGGAGC -3'
Posted On 2016-04-27