Incidental Mutation 'R4972:Mpzl3'
ID 384528
Institutional Source Beutler Lab
Gene Symbol Mpzl3
Ensembl Gene ENSMUSG00000070305
Gene Name myelin protein zero-like 3
Synonyms rc, 5430427F17Rik, ruf, A530065I17Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.071) question?
Stock # R4972 (G1)
Quality Score 151
Status Validated
Chromosome 9
Chromosomal Location 44966484-44988734 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) T to A at 44973554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114663] [ENSMUST00000114664]
AlphaFold Q3V3F6
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093856
SMART Domains Protein: ENSMUSP00000091378
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Blast:IG 38 82 5e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114663
SMART Domains Protein: ENSMUSP00000110311
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 230 6e-26 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114664
SMART Domains Protein: ENSMUSP00000110312
Gene: ENSMUSG00000070305

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
IG 38 149 3.35e-5 SMART
Blast:IG_like 150 229 3e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187113
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous allele have a rough coat that becomes brittle and oily with age, and display stunted growth, cyclic and progressive hair loss, hyperplastic epidermis, abnormal hair follicles, myocardial degeneration, and reduced collagen and elastin content in the skin and heart. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Mpzl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02420:Mpzl3 APN 9 44,977,815 (GRCm39) missense possibly damaging 0.95
IGL02969:Mpzl3 APN 9 44,979,514 (GRCm39) missense probably benign 0.00
mausolus UTSW 9 44,979,550 (GRCm39) missense probably damaging 1.00
satrap UTSW 9 44,966,542 (GRCm39) start codon destroyed probably null 0.06
R0069:Mpzl3 UTSW 9 44,979,550 (GRCm39) missense probably damaging 1.00
R0196:Mpzl3 UTSW 9 44,973,458 (GRCm39) missense probably damaging 0.98
R0557:Mpzl3 UTSW 9 44,977,806 (GRCm39) missense probably damaging 1.00
R1511:Mpzl3 UTSW 9 44,977,827 (GRCm39) missense probably damaging 0.99
R4580:Mpzl3 UTSW 9 44,979,529 (GRCm39) missense possibly damaging 0.94
R4775:Mpzl3 UTSW 9 44,977,730 (GRCm39) missense probably damaging 1.00
R4825:Mpzl3 UTSW 9 44,979,627 (GRCm39) missense probably benign 0.00
R5189:Mpzl3 UTSW 9 44,973,408 (GRCm39) missense possibly damaging 0.95
R5371:Mpzl3 UTSW 9 44,966,510 (GRCm39) utr 5 prime probably benign
R5925:Mpzl3 UTSW 9 44,973,412 (GRCm39) missense probably damaging 1.00
R7191:Mpzl3 UTSW 9 44,966,542 (GRCm39) start codon destroyed probably null 0.06
R7561:Mpzl3 UTSW 9 44,966,610 (GRCm39) missense probably benign
R7570:Mpzl3 UTSW 9 44,981,985 (GRCm39) missense probably benign
R9057:Mpzl3 UTSW 9 44,979,592 (GRCm39) missense probably damaging 1.00
R9101:Mpzl3 UTSW 9 44,981,983 (GRCm39) missense possibly damaging 0.65
R9400:Mpzl3 UTSW 9 44,986,077 (GRCm39) missense possibly damaging 0.59
R9579:Mpzl3 UTSW 9 44,973,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTAGGTGCGCGTATCGTC -3'
(R):5'- CAACTGTTGACTTCCTCCATGG -3'

Sequencing Primer
(F):5'- AGATAAGTGCCGATGCTCACGTC -3'
(R):5'- CATGGCTCTCAGGGATAGAACC -3'
Posted On 2016-04-27