Incidental Mutation 'R4972:Ttc21a'
ID 384536
Institutional Source Beutler Lab
Gene Symbol Ttc21a
Ensembl Gene ENSMUSG00000032514
Gene Name tetratricopeptide repeat domain 21A
Synonyms Thm2, 4921538N17Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 119766672-119796859 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 119774027 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 245 (E245K)
Ref Sequence ENSEMBL: ENSMUSP00000035100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035100] [ENSMUST00000177637]
AlphaFold Q8C0S4
Predicted Effect probably benign
Transcript: ENSMUST00000035100
AA Change: E245K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000035100
Gene: ENSMUSG00000032514
AA Change: E245K

DomainStartEndE-ValueType
low complexity region 107 118 N/A INTRINSIC
Blast:TPR 214 247 6e-11 BLAST
TPR 326 359 4.55e1 SMART
TPR 494 527 1.97e1 SMART
Blast:TPR 528 561 1e-14 BLAST
TPR 565 598 2.63e1 SMART
Blast:TPR 617 649 6e-11 BLAST
TPR 721 754 1.33e0 SMART
TPR 755 788 4.84e-3 SMART
TPR 790 821 1.14e1 SMART
TPR 883 916 9.03e-3 SMART
low complexity region 921 935 N/A INTRINSIC
TPR 951 984 1.08e1 SMART
Blast:TPR 1022 1054 3e-12 BLAST
low complexity region 1117 1129 N/A INTRINSIC
TPR 1195 1228 2.22e-2 SMART
TPR 1264 1297 9.73e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160790
Predicted Effect probably benign
Transcript: ENSMUST00000177637
SMART Domains Protein: ENSMUSP00000136413
Gene: ENSMUSG00000052336

DomainStartEndE-ValueType
Pfam:7tm_1 49 294 3.5e-50 PFAM
Meta Mutation Damage Score 0.0729 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Actn1 T C 12: 80,219,813 (GRCm39) D686G probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Ttc21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Ttc21a APN 9 119,794,885 (GRCm39) missense probably damaging 0.96
IGL01996:Ttc21a APN 9 119,787,182 (GRCm39) missense probably damaging 0.99
IGL02160:Ttc21a APN 9 119,785,989 (GRCm39) missense probably damaging 1.00
IGL02163:Ttc21a APN 9 119,779,901 (GRCm39) nonsense probably null
IGL02252:Ttc21a APN 9 119,785,994 (GRCm39) missense probably damaging 1.00
IGL02901:Ttc21a APN 9 119,787,347 (GRCm39) missense probably damaging 0.98
IGL03105:Ttc21a APN 9 119,771,642 (GRCm39) missense probably benign 0.01
IGL03155:Ttc21a APN 9 119,773,042 (GRCm39) critical splice donor site probably null
IGL03323:Ttc21a APN 9 119,769,602 (GRCm39) intron probably benign
R0054:Ttc21a UTSW 9 119,773,006 (GRCm39) missense probably damaging 1.00
R0398:Ttc21a UTSW 9 119,783,628 (GRCm39) missense probably damaging 1.00
R0452:Ttc21a UTSW 9 119,768,220 (GRCm39) intron probably benign
R0541:Ttc21a UTSW 9 119,785,892 (GRCm39) intron probably benign
R0545:Ttc21a UTSW 9 119,787,865 (GRCm39) missense probably damaging 0.99
R0605:Ttc21a UTSW 9 119,790,908 (GRCm39) missense possibly damaging 0.93
R1352:Ttc21a UTSW 9 119,783,718 (GRCm39) missense possibly damaging 0.49
R1417:Ttc21a UTSW 9 119,783,327 (GRCm39) missense probably damaging 0.99
R1471:Ttc21a UTSW 9 119,771,707 (GRCm39) missense probably damaging 1.00
R1479:Ttc21a UTSW 9 119,786,013 (GRCm39) missense probably benign 0.00
R1631:Ttc21a UTSW 9 119,783,228 (GRCm39) splice site probably null
R1905:Ttc21a UTSW 9 119,795,823 (GRCm39) missense possibly damaging 0.82
R2141:Ttc21a UTSW 9 119,793,361 (GRCm39) missense probably damaging 0.98
R2213:Ttc21a UTSW 9 119,769,527 (GRCm39) missense probably benign 0.01
R2265:Ttc21a UTSW 9 119,788,074 (GRCm39) missense possibly damaging 0.62
R2327:Ttc21a UTSW 9 119,795,189 (GRCm39) missense probably damaging 1.00
R2656:Ttc21a UTSW 9 119,770,331 (GRCm39) missense probably damaging 0.98
R3000:Ttc21a UTSW 9 119,781,320 (GRCm39) missense probably benign 0.02
R3792:Ttc21a UTSW 9 119,783,231 (GRCm39) missense probably damaging 1.00
R3938:Ttc21a UTSW 9 119,779,882 (GRCm39) intron probably benign
R4232:Ttc21a UTSW 9 119,771,684 (GRCm39) missense probably benign 0.00
R4492:Ttc21a UTSW 9 119,770,346 (GRCm39) missense probably benign 0.00
R4498:Ttc21a UTSW 9 119,787,885 (GRCm39) missense possibly damaging 0.82
R4655:Ttc21a UTSW 9 119,790,828 (GRCm39) missense possibly damaging 0.80
R4890:Ttc21a UTSW 9 119,788,103 (GRCm39) missense probably benign
R4960:Ttc21a UTSW 9 119,774,067 (GRCm39) missense possibly damaging 0.51
R5015:Ttc21a UTSW 9 119,795,195 (GRCm39) missense probably damaging 0.98
R5092:Ttc21a UTSW 9 119,771,731 (GRCm39) missense probably benign 0.01
R5117:Ttc21a UTSW 9 119,795,631 (GRCm39) missense possibly damaging 0.64
R5123:Ttc21a UTSW 9 119,781,278 (GRCm39) missense probably benign 0.04
R5452:Ttc21a UTSW 9 119,780,037 (GRCm39) missense probably benign 0.00
R5733:Ttc21a UTSW 9 119,770,327 (GRCm39) missense probably benign
R5734:Ttc21a UTSW 9 119,795,732 (GRCm39) missense probably benign
R5869:Ttc21a UTSW 9 119,787,858 (GRCm39) missense probably benign 0.03
R6214:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6215:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
R6279:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6284:Ttc21a UTSW 9 119,773,028 (GRCm39) missense probably damaging 1.00
R6300:Ttc21a UTSW 9 119,790,905 (GRCm39) missense possibly damaging 0.78
R6800:Ttc21a UTSW 9 119,770,268 (GRCm39) missense possibly damaging 0.61
R6833:Ttc21a UTSW 9 119,771,701 (GRCm39) missense probably benign 0.24
R7009:Ttc21a UTSW 9 119,787,139 (GRCm39) nonsense probably null
R7060:Ttc21a UTSW 9 119,795,742 (GRCm39) missense probably damaging 0.98
R7170:Ttc21a UTSW 9 119,774,607 (GRCm39) missense probably damaging 0.99
R7418:Ttc21a UTSW 9 119,788,117 (GRCm39) missense probably benign 0.01
R7438:Ttc21a UTSW 9 119,774,605 (GRCm39) missense probably damaging 1.00
R7595:Ttc21a UTSW 9 119,787,135 (GRCm39) missense probably benign 0.12
R7703:Ttc21a UTSW 9 119,788,095 (GRCm39) missense probably benign 0.14
R8076:Ttc21a UTSW 9 119,795,392 (GRCm39) missense probably benign 0.01
R8217:Ttc21a UTSW 9 119,783,694 (GRCm39) missense probably benign 0.00
R8471:Ttc21a UTSW 9 119,792,242 (GRCm39) splice site probably null
R8558:Ttc21a UTSW 9 119,787,835 (GRCm39) missense probably damaging 0.97
R8696:Ttc21a UTSW 9 119,772,977 (GRCm39) missense possibly damaging 0.80
R8739:Ttc21a UTSW 9 119,796,371 (GRCm39) missense probably benign 0.00
R8768:Ttc21a UTSW 9 119,770,286 (GRCm39) missense probably damaging 1.00
R8912:Ttc21a UTSW 9 119,770,367 (GRCm39) critical splice donor site probably null
R9006:Ttc21a UTSW 9 119,792,130 (GRCm39) intron probably benign
R9214:Ttc21a UTSW 9 119,772,941 (GRCm39) missense probably benign 0.17
R9235:Ttc21a UTSW 9 119,774,559 (GRCm39) missense probably benign 0.03
R9521:Ttc21a UTSW 9 119,787,181 (GRCm39) missense probably damaging 0.98
R9643:Ttc21a UTSW 9 119,771,686 (GRCm39) missense probably benign
RF004:Ttc21a UTSW 9 119,795,838 (GRCm39) missense probably damaging 1.00
Z1177:Ttc21a UTSW 9 119,771,746 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTGCTGGGAATTGAACTCAG -3'
(R):5'- TGGACGGACAGGGTTTTGAC -3'

Sequencing Primer
(F):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
(R):5'- AGGGTTTTGACCTGAACTCATC -3'
Posted On 2016-04-27