Incidental Mutation 'R4972:Vezt'
ID 384540
Institutional Source Beutler Lab
Gene Symbol Vezt
Ensembl Gene ENSMUSG00000036099
Gene Name vezatin, adherens junctions transmembrane protein
Synonyms
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4972 (G1)
Quality Score 217
Status Validated
Chromosome 10
Chromosomal Location 93939165-94035817 bp(-) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 94000350 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047711] [ENSMUST00000118077] [ENSMUST00000118205] [ENSMUST00000119818] [ENSMUST00000123201] [ENSMUST00000123201] [ENSMUST00000141241] [ENSMUST00000150344] [ENSMUST00000150344] [ENSMUST00000150704]
AlphaFold Q3ZK22
Predicted Effect probably null
Transcript: ENSMUST00000047711
SMART Domains Protein: ENSMUSP00000037955
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1.6e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
low complexity region 702 715 N/A INTRINSIC
low complexity region 764 779 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118077
SMART Domains Protein: ENSMUSP00000113983
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 9.2e-61 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118205
SMART Domains Protein: ENSMUSP00000113321
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 440 1e-60 PFAM
low complexity region 566 581 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119818
SMART Domains Protein: ENSMUSP00000113715
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 150 442 1e-93 PFAM
low complexity region 570 585 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 768 783 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000123201
SMART Domains Protein: ENSMUSP00000114550
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 120 190 2.1e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000123201
SMART Domains Protein: ENSMUSP00000114550
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 120 190 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132735
Predicted Effect probably benign
Transcript: ENSMUST00000141241
SMART Domains Protein: ENSMUSP00000123575
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
Pfam:Vezatin 1 97 1.2e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000150344
SMART Domains Protein: ENSMUSP00000122561
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150344
SMART Domains Protein: ENSMUSP00000122561
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 120 137 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150704
SMART Domains Protein: ENSMUSP00000121727
Gene: ENSMUSG00000036099

DomainStartEndE-ValueType
low complexity region 100 117 N/A INTRINSIC
Pfam:Vezatin 149 256 1.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154267
Meta Mutation Damage Score 0.9591 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: This gene encodes a transmembrane protein that is essential for the formation of adherens junctions. It is required for both the pre-implantation morphogenesis of a blastocyst and for the implantation process. The encoded protein is also a component of the ankle-link complex in cochlear hair cells, where it may effect resilience to sound trauma. It is also thought to be involved in dendritic spine morphogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a null allele develop to the blastocyst stage inducing a decidual response but die at implantation. Only about half of blastocysts are able to hatch upon in vitro culture and mutant outgrowths show severe defects in intercellular adhesion and signs of cellular degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Vezt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Vezt APN 10 93996857 missense probably damaging 1.00
IGL01655:Vezt APN 10 93996997 missense probably benign 0.00
IGL02014:Vezt APN 10 93996949 missense probably benign 0.35
IGL03072:Vezt APN 10 93974033 missense probably damaging 1.00
R0542:Vezt UTSW 10 94007096 critical splice acceptor site probably null
R1633:Vezt UTSW 10 93984276 missense probably damaging 1.00
R1757:Vezt UTSW 10 93970563 missense probably benign
R1808:Vezt UTSW 10 93990164 missense probably damaging 1.00
R4296:Vezt UTSW 10 93973931 small deletion probably benign
R5079:Vezt UTSW 10 94020624 splice site probably null
R5137:Vezt UTSW 10 93970510 missense probably benign 0.00
R5319:Vezt UTSW 10 93970331 missense probably benign
R5743:Vezt UTSW 10 93997095 missense probably benign 0.01
R6002:Vezt UTSW 10 94000474 missense probably damaging 1.00
R6281:Vezt UTSW 10 93973946 missense probably benign 0.04
R6652:Vezt UTSW 10 93970279 missense probably damaging 1.00
R6681:Vezt UTSW 10 93996997 missense probably benign 0.00
R6914:Vezt UTSW 10 93970451 missense probably benign
R7100:Vezt UTSW 10 93996933 missense probably benign 0.13
R7131:Vezt UTSW 10 93970547 nonsense probably null
R7743:Vezt UTSW 10 93980424 missense probably damaging 1.00
R8137:Vezt UTSW 10 93939292 missense
R8393:Vezt UTSW 10 93996842 missense probably damaging 1.00
R9006:Vezt UTSW 10 93974012 missense probably benign
R9043:Vezt UTSW 10 93984165 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTAGTTGTTGAGTTGCTAAAATGC -3'
(R):5'- TGTTTTGGTGGCAAGGACAC -3'

Sequencing Primer
(F):5'- GTTGAGTTGCTAAAATGCAGAAC -3'
(R):5'- TGGCAAGGACACCGGGTTTC -3'
Posted On 2016-04-27