Mutagenetix > Incidental Mutations

Incidental Mutation 'R4972:Actn1'

384543

Institutional Source

Beutler Lab

Gene Symbol

Actn1

Ensembl Gene

ENSMUSG00000015143

Gene Name

actinin, alpha 1

Synonyms

MMRRC Submission

042567-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.432) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80167547-80260371 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80173039 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 686 (D686G)

Ref Sequence

ENSEMBL: ENSMUSP00000021554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]

Predicted Effect

probably benign
Transcript: ENSMUST00000021554
AA Change: D686G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: D686G

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	5.9e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	4.7e-14	PFAM
EFh	750	778	1.73e-5	SMART
EFh	791	819	8.13e-2	SMART
efhand_Ca_insen	822	888	5.22e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167327
AA Change: D686G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: D686G

Domain	Start	End	E-Value	Type
CH	33	133	4.24e-23	SMART
CH	146	245	5.06e-21	SMART
Pfam:Spectrin	274	384	1.7e-17	PFAM
SPEC	397	498	1.69e-25	SMART
SPEC	512	619	1.47e-2	SMART
Pfam:Spectrin	630	733	8.4e-14	PFAM
EFh	750	778	1.36e0	SMART
EFh	786	814	8.13e-2	SMART
efhand_Ca_insen	817	883	5.22e-38	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219382

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219634

Meta Mutation Damage Score

0.2675

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Prph2	G	T	17: 46,910,807	L37F	possibly damaging	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Actn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01090:Actn1	APN	12	80199072	splice site	probably null
IGL01152:Actn1	APN	12	80199046	missense	probably damaging	1.00
IGL01386:Actn1	APN	12	80193672	missense	probably benign	0.03
IGL01890:Actn1	APN	12	80184868	missense	probably damaging	0.99
IGL01937:Actn1	APN	12	80171763	missense	probably benign	0.03
IGL02142:Actn1	APN	12	80176155	critical splice donor site	probably null
IGL02191:Actn1	APN	12	80174109	missense	probably benign
IGL02217:Actn1	APN	12	80174094	nonsense	probably null
IGL02230:Actn1	APN	12	80171830	missense	probably benign	0.02
IGL03163:Actn1	APN	12	80181417	missense	probably benign	0.33
IGL03401:Actn1	APN	12	80168967	nonsense	probably null
R0538:Actn1	UTSW	12	80260100	unclassified	probably benign
R0546:Actn1	UTSW	12	80178434	missense	probably benign
R0583:Actn1	UTSW	12	80199029	missense	probably damaging	1.00
R0606:Actn1	UTSW	12	80174647	splice site	probably benign
R1340:Actn1	UTSW	12	80173144	critical splice acceptor site	probably null
R1519:Actn1	UTSW	12	80205078	missense	probably damaging	1.00
R1572:Actn1	UTSW	12	80172957	splice site	probably benign
R1619:Actn1	UTSW	12	80173022	missense	probably damaging	1.00
R1677:Actn1	UTSW	12	80260032	missense	probably benign	0.02
R1994:Actn1	UTSW	12	80204971	nonsense	probably null
R2102:Actn1	UTSW	12	80183517	missense	probably benign	0.38
R2157:Actn1	UTSW	12	80173117	missense	probably benign	0.04
R2191:Actn1	UTSW	12	80171802	nonsense	probably null
R2519:Actn1	UTSW	12	80192389	missense	probably damaging	1.00
R2988:Actn1	UTSW	12	80192388	missense	possibly damaging	0.78
R4024:Actn1	UTSW	12	80168477	missense	probably damaging	1.00
R4589:Actn1	UTSW	12	80171799	missense	possibly damaging	0.53
R4907:Actn1	UTSW	12	80181414	missense	probably damaging	0.99
R4936:Actn1	UTSW	12	80172998	missense	probably benign	0.09
R4966:Actn1	UTSW	12	80173130	missense	probably benign	0.01
R5395:Actn1	UTSW	12	80170703	missense	probably benign
R5460:Actn1	UTSW	12	80183568	missense	probably benign	0.00
R5467:Actn1	UTSW	12	80176217	missense	possibly damaging	0.86
R5470:Actn1	UTSW	12	80168941	missense	probably damaging	0.99
R5661:Actn1	UTSW	12	80184844	missense	probably benign	0.09
R5985:Actn1	UTSW	12	80168395	missense	probably damaging	1.00
R6020:Actn1	UTSW	12	80174455	splice site	probably null
R6042:Actn1	UTSW	12	80177249	missense	probably benign	0.04
R6389:Actn1	UTSW	12	80174522	missense	probably benign
R6499:Actn1	UTSW	12	80168417	missense	possibly damaging	0.59
R6709:Actn1	UTSW	12	80193644	missense	probably damaging	1.00
R7016:Actn1	UTSW	12	80172968	missense	possibly damaging	0.94
R7116:Actn1	UTSW	12	80204977	missense	probably damaging	1.00
R7173:Actn1	UTSW	12	80177259	missense	possibly damaging	0.70
R7183:Actn1	UTSW	12	80168932	missense	possibly damaging	0.87
R7291:Actn1	UTSW	12	80174085	missense	probably benign	0.00
R7361:Actn1	UTSW	12	80193715	missense	probably benign	0.01
R7452:Actn1	UTSW	12	80183602	missense	probably benign	0.12
R7698:Actn1	UTSW	12	80174537	missense	probably benign	0.00
R7701:Actn1	UTSW	12	80174554	missense	possibly damaging	0.88
R8000:Actn1	UTSW	12	80199008	missense	probably damaging	1.00
R8171:Actn1	UTSW	12	80196393	critical splice donor site	probably null
R8287:Actn1	UTSW	12	80174078	critical splice donor site	probably null
R8469:Actn1	UTSW	12	80193683	missense	possibly damaging	0.95
R8794:Actn1	UTSW	12	80198980	critical splice donor site	probably benign
R8887:Actn1	UTSW	12	80168423	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGGTGCAGAGTTTCAGG -3'
(R):5'- GCCAGTGCTAACCTCTTTAGG -3'

Sequencing Primer
(F):5'- TGCAGAGTTTCAGGGGCAG -3'
(R):5'- CCTCTTTAGGGCTTGGAAGATAGC -3'

Posted On

2016-04-27