Incidental Mutation 'R4972:Actn1'
ID 384543
Institutional Source Beutler Lab
Gene Symbol Actn1
Ensembl Gene ENSMUSG00000015143
Gene Name actinin, alpha 1
Synonyms 3110023F10Rik
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.488) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 80214321-80307145 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80219813 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 686 (D686G)
Ref Sequence ENSEMBL: ENSMUSP00000021554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021554] [ENSMUST00000167327]
AlphaFold Q7TPR4
Predicted Effect probably benign
Transcript: ENSMUST00000021554
AA Change: D686G

PolyPhen 2 Score 0.346 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021554
Gene: ENSMUSG00000015143
AA Change: D686G

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 5.9e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 4.7e-14 PFAM
EFh 750 778 1.73e-5 SMART
EFh 791 819 8.13e-2 SMART
efhand_Ca_insen 822 888 5.22e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167327
AA Change: D686G

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127176
Gene: ENSMUSG00000015143
AA Change: D686G

DomainStartEndE-ValueType
CH 33 133 4.24e-23 SMART
CH 146 245 5.06e-21 SMART
Pfam:Spectrin 274 384 1.7e-17 PFAM
SPEC 397 498 1.69e-25 SMART
SPEC 512 619 1.47e-2 SMART
Pfam:Spectrin 630 733 8.4e-14 PFAM
EFh 750 778 1.36e0 SMART
EFh 786 814 8.13e-2 SMART
efhand_Ca_insen 817 883 5.22e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219634
Meta Mutation Damage Score 0.2675 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a nonmuscle, cytoskeletal, alpha actinin isoform and maps to the same site as the structurally similar erythroid beta spectrin gene. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,383,361 (GRCm39) I868N possibly damaging Het
A730013G03Rik C G 1: 192,516,081 (GRCm39) noncoding transcript Het
Actl11 A G 9: 107,807,155 (GRCm39) T493A probably benign Het
Adamts1 G A 16: 85,592,833 (GRCm39) T525I probably damaging Het
Adcy10 T A 1: 165,384,431 (GRCm39) L1064H probably damaging Het
AI661453 A T 17: 47,777,324 (GRCm39) probably benign Het
Apba1 T A 19: 23,889,900 (GRCm39) S433T probably benign Het
Arid4b T A 13: 14,334,857 (GRCm39) N355K probably benign Het
Bsn A T 9: 107,992,377 (GRCm39) M1125K probably damaging Het
C2cd5 A T 6: 142,958,950 (GRCm39) M1003K probably damaging Het
Ccdc18 A G 5: 108,339,869 (GRCm39) M805V probably benign Het
Cep89 T G 7: 35,131,977 (GRCm39) L637R probably damaging Het
Col24a1 A T 3: 145,215,439 (GRCm39) I1444F probably benign Het
Commd4 A T 9: 57,062,732 (GRCm39) S175T probably benign Het
Coq7 A G 7: 118,109,340 (GRCm39) V236A unknown Het
Dctn2 C T 10: 127,112,572 (GRCm39) R176C probably damaging Het
Ddx31 T C 2: 28,750,782 (GRCm39) F389L probably damaging Het
Dgkz C T 2: 91,776,047 (GRCm39) R72H probably benign Het
Dpysl4 A G 7: 138,670,206 (GRCm39) D24G probably damaging Het
Dydc1 A G 14: 40,804,295 (GRCm39) T106A probably benign Het
F13b A G 1: 139,438,661 (GRCm39) Y355C probably damaging Het
Fcrl5 A G 3: 87,361,957 (GRCm39) M407V probably benign Het
Fzd5 C A 1: 64,775,171 (GRCm39) V197L probably benign Het
Galnt16 G T 12: 80,619,103 (GRCm39) E70* probably null Het
Gpr171 A T 3: 59,005,386 (GRCm39) F130I probably damaging Het
Grin3a T C 4: 49,770,484 (GRCm39) N763D probably damaging Het
Gsta2 A T 9: 78,244,961 (GRCm39) M51K probably damaging Het
Gvin-ps3 T C 7: 105,682,521 (GRCm39) noncoding transcript Het
Hacd3 A T 9: 64,897,718 (GRCm39) I298N probably damaging Het
Il18r1 C T 1: 40,530,224 (GRCm39) P317L probably benign Het
Iscu T A 5: 113,915,037 (GRCm39) probably benign Het
Kif6 A G 17: 50,014,647 (GRCm39) D250G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lcn6 T A 2: 25,570,079 (GRCm39) C82S probably damaging Het
Mob4 C G 1: 55,190,161 (GRCm39) L135V possibly damaging Het
Mpzl3 T A 9: 44,973,554 (GRCm39) probably benign Het
Mvp T C 7: 126,588,970 (GRCm39) D599G probably damaging Het
Myo1a T C 10: 127,552,178 (GRCm39) Y766H probably benign Het
Myo5b A G 18: 74,760,264 (GRCm39) H260R probably damaging Het
Nbea C T 3: 55,992,667 (GRCm39) R313H probably damaging Het
Necab1 T A 4: 14,978,216 (GRCm39) D211V probably damaging Het
Nefl G T 14: 68,324,212 (GRCm39) probably benign Het
Nfx1 T A 4: 40,976,375 (GRCm39) D16E probably benign Het
Nlrp9a G T 7: 26,269,964 (GRCm39) C797F probably damaging Het
Or4k36 T A 2: 111,146,163 (GRCm39) V113E probably damaging Het
Or5p5 A G 7: 107,413,953 (GRCm39) Q56R probably benign Het
Pde6b A G 5: 108,573,130 (GRCm39) D500G probably benign Het
Pgs1 T C 11: 117,896,719 (GRCm39) probably null Het
Polr3b T A 10: 84,473,988 (GRCm39) I189N probably damaging Het
Ppwd1 A T 13: 104,356,616 (GRCm39) S300T probably benign Het
Prl2c2 A C 13: 13,176,755 (GRCm39) N55K possibly damaging Het
Prpf19 C T 19: 10,876,709 (GRCm39) probably benign Het
Prph2 G T 17: 47,221,733 (GRCm39) L37F possibly damaging Het
Ptprg G T 14: 12,226,427 (GRCm38) R565L possibly damaging Het
Rab8a C T 8: 72,925,119 (GRCm39) T74M probably damaging Het
Rexo1 A T 10: 80,385,527 (GRCm39) F510L probably damaging Het
Rexo2 G T 9: 48,390,689 (GRCm39) T51K probably damaging Het
Sh3d21 T C 4: 126,046,209 (GRCm39) K147R possibly damaging Het
Skint6 A G 4: 112,692,265 (GRCm39) I1062T probably benign Het
Spag16 C T 1: 70,764,087 (GRCm39) R636W probably damaging Het
Spata16 T C 3: 26,894,872 (GRCm39) I307T possibly damaging Het
Speer4f2 T G 5: 17,579,423 (GRCm39) I74S probably benign Het
Svep1 T A 4: 58,087,778 (GRCm39) Y1767F possibly damaging Het
Swt1 T C 1: 151,299,293 (GRCm39) S7G probably benign Het
Tex9 A G 9: 72,385,620 (GRCm39) probably null Het
Thsd7b C A 1: 130,116,309 (GRCm39) P1354H probably damaging Het
Ticrr A G 7: 79,319,416 (GRCm39) D467G probably damaging Het
Tmco5b A C 2: 113,127,338 (GRCm39) D303A probably damaging Het
Trpm7 A G 2: 126,665,978 (GRCm39) V876A probably damaging Het
Ttc21a G A 9: 119,774,027 (GRCm39) E245K probably benign Het
Vezt C T 10: 93,836,212 (GRCm39) probably null Het
Zscan20 G A 4: 128,486,152 (GRCm39) P183S probably benign Het
Other mutations in Actn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Actn1 APN 12 80,245,846 (GRCm39) splice site probably null
IGL01152:Actn1 APN 12 80,245,820 (GRCm39) missense probably damaging 1.00
IGL01386:Actn1 APN 12 80,240,446 (GRCm39) missense probably benign 0.03
IGL01890:Actn1 APN 12 80,231,642 (GRCm39) missense probably damaging 0.99
IGL01937:Actn1 APN 12 80,218,537 (GRCm39) missense probably benign 0.03
IGL02142:Actn1 APN 12 80,222,929 (GRCm39) critical splice donor site probably null
IGL02191:Actn1 APN 12 80,220,883 (GRCm39) missense probably benign
IGL02217:Actn1 APN 12 80,220,868 (GRCm39) nonsense probably null
IGL02230:Actn1 APN 12 80,218,604 (GRCm39) missense probably benign 0.02
IGL03163:Actn1 APN 12 80,228,191 (GRCm39) missense probably benign 0.33
IGL03401:Actn1 APN 12 80,215,741 (GRCm39) nonsense probably null
R0538:Actn1 UTSW 12 80,306,874 (GRCm39) unclassified probably benign
R0546:Actn1 UTSW 12 80,225,208 (GRCm39) missense probably benign
R0583:Actn1 UTSW 12 80,245,803 (GRCm39) missense probably damaging 1.00
R0606:Actn1 UTSW 12 80,221,421 (GRCm39) splice site probably benign
R1340:Actn1 UTSW 12 80,219,918 (GRCm39) critical splice acceptor site probably null
R1519:Actn1 UTSW 12 80,251,852 (GRCm39) missense probably damaging 1.00
R1572:Actn1 UTSW 12 80,219,731 (GRCm39) splice site probably benign
R1619:Actn1 UTSW 12 80,219,796 (GRCm39) missense probably damaging 1.00
R1677:Actn1 UTSW 12 80,306,806 (GRCm39) missense probably benign 0.02
R1994:Actn1 UTSW 12 80,251,745 (GRCm39) nonsense probably null
R2102:Actn1 UTSW 12 80,230,291 (GRCm39) missense probably benign 0.38
R2157:Actn1 UTSW 12 80,219,891 (GRCm39) missense probably benign 0.04
R2191:Actn1 UTSW 12 80,218,576 (GRCm39) nonsense probably null
R2519:Actn1 UTSW 12 80,239,163 (GRCm39) missense probably damaging 1.00
R2988:Actn1 UTSW 12 80,239,162 (GRCm39) missense possibly damaging 0.78
R4024:Actn1 UTSW 12 80,215,251 (GRCm39) missense probably damaging 1.00
R4589:Actn1 UTSW 12 80,218,573 (GRCm39) missense possibly damaging 0.53
R4907:Actn1 UTSW 12 80,228,188 (GRCm39) missense probably damaging 0.99
R4936:Actn1 UTSW 12 80,219,772 (GRCm39) missense probably benign 0.09
R4966:Actn1 UTSW 12 80,219,904 (GRCm39) missense probably benign 0.01
R5395:Actn1 UTSW 12 80,217,477 (GRCm39) missense probably benign
R5460:Actn1 UTSW 12 80,230,342 (GRCm39) missense probably benign 0.00
R5467:Actn1 UTSW 12 80,222,991 (GRCm39) missense possibly damaging 0.86
R5470:Actn1 UTSW 12 80,215,715 (GRCm39) missense probably damaging 0.99
R5661:Actn1 UTSW 12 80,231,618 (GRCm39) missense probably benign 0.09
R5985:Actn1 UTSW 12 80,215,169 (GRCm39) missense probably damaging 1.00
R6020:Actn1 UTSW 12 80,221,229 (GRCm39) splice site probably null
R6042:Actn1 UTSW 12 80,224,023 (GRCm39) missense probably benign 0.04
R6389:Actn1 UTSW 12 80,221,296 (GRCm39) missense probably benign
R6499:Actn1 UTSW 12 80,215,191 (GRCm39) missense possibly damaging 0.59
R6709:Actn1 UTSW 12 80,240,418 (GRCm39) missense probably damaging 1.00
R7016:Actn1 UTSW 12 80,219,742 (GRCm39) missense possibly damaging 0.94
R7116:Actn1 UTSW 12 80,251,751 (GRCm39) missense probably damaging 1.00
R7173:Actn1 UTSW 12 80,224,033 (GRCm39) missense possibly damaging 0.70
R7183:Actn1 UTSW 12 80,215,706 (GRCm39) missense possibly damaging 0.87
R7291:Actn1 UTSW 12 80,220,859 (GRCm39) missense probably benign 0.00
R7361:Actn1 UTSW 12 80,240,489 (GRCm39) missense probably benign 0.01
R7452:Actn1 UTSW 12 80,230,376 (GRCm39) missense probably benign 0.12
R7698:Actn1 UTSW 12 80,221,311 (GRCm39) missense probably benign 0.00
R7701:Actn1 UTSW 12 80,221,328 (GRCm39) missense possibly damaging 0.88
R8000:Actn1 UTSW 12 80,245,782 (GRCm39) missense probably damaging 1.00
R8171:Actn1 UTSW 12 80,243,167 (GRCm39) critical splice donor site probably null
R8287:Actn1 UTSW 12 80,220,852 (GRCm39) critical splice donor site probably null
R8469:Actn1 UTSW 12 80,240,457 (GRCm39) missense possibly damaging 0.95
R8794:Actn1 UTSW 12 80,245,754 (GRCm39) critical splice donor site probably benign
R8887:Actn1 UTSW 12 80,215,197 (GRCm39) missense probably damaging 1.00
R9237:Actn1 UTSW 12 80,240,470 (GRCm39) missense possibly damaging 0.92
R9269:Actn1 UTSW 12 80,219,745 (GRCm39) missense probably benign 0.01
R9520:Actn1 UTSW 12 80,240,417 (GRCm39) missense probably damaging 1.00
R9526:Actn1 UTSW 12 80,230,393 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGTGCAGAGTTTCAGG -3'
(R):5'- GCCAGTGCTAACCTCTTTAGG -3'

Sequencing Primer
(F):5'- TGCAGAGTTTCAGGGGCAG -3'
(R):5'- CCTCTTTAGGGCTTGGAAGATAGC -3'
Posted On 2016-04-27