Incidental Mutation 'R4972:Ptprg'
ID 384547
Institutional Source Beutler Lab
Gene Symbol Ptprg
Ensembl Gene ENSMUSG00000021745
Gene Name protein tyrosine phosphatase, receptor type, G
Synonyms 5430405N12Rik, RPTPgamma
MMRRC Submission 042567-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4972 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 11553532-12242041 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 12226427 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 565 (R565L)
Ref Sequence ENSEMBL: ENSMUSP00000113679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022264] [ENSMUST00000119888] [ENSMUST00000142917]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000022264
AA Change: R1340L

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022264
Gene: ENSMUSG00000021745
AA Change: R1340L

DomainStartEndE-ValueType
Carb_anhydrase 60 321 6.38e-109 SMART
FN3 347 433 5.4e-7 SMART
low complexity region 474 484 N/A INTRINSIC
low complexity region 515 525 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
transmembrane domain 734 756 N/A INTRINSIC
PTPc 844 1118 1.76e-136 SMART
PTPc 1146 1409 1.32e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119888
AA Change: R565L

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113679
Gene: ENSMUSG00000021745
AA Change: R565L

DomainStartEndE-ValueType
PTPc 69 343 1.76e-136 SMART
PTPc 371 634 1.32e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134290
Predicted Effect probably benign
Transcript: ENSMUST00000142917
SMART Domains Protein: ENSMUSP00000121268
Gene: ENSMUSG00000021745

DomainStartEndE-ValueType
Carb_anhydrase 60 260 1.6e-50 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this PTP contains a carbonic anhydrase-like (CAH) domain, which is also found in the extracellular region of PTPRBETA/ZETA. This gene is located in a chromosomal region that is frequently deleted in renal cell carcinoma and lung carcinoma, thus is thought to be a candidate tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overtly normal but exhibit minor behavioral changes including specific motor deficits, reduced latency to react in the tail flick test, enhanced sensory processing for acoustic stimuli, and reduced performance with cued fear conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Prph2 G T 17: 46,910,807 L37F possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Ptprg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ptprg APN 14 12215992 missense probably damaging 1.00
IGL00484:Ptprg APN 14 12215220 missense probably damaging 0.99
IGL00847:Ptprg APN 14 12215265 missense probably damaging 1.00
IGL01089:Ptprg APN 14 12215286 missense probably damaging 0.97
IGL01382:Ptprg APN 14 12237797 missense probably benign 0.16
IGL01470:Ptprg APN 14 12213702 nonsense probably null
IGL01762:Ptprg APN 14 12037386 missense probably benign 0.00
IGL01886:Ptprg APN 14 12179280 missense probably benign 0.22
IGL01963:Ptprg APN 14 12220661 missense probably damaging 1.00
IGL02015:Ptprg APN 14 12237782 missense possibly damaging 0.46
IGL02086:Ptprg APN 14 12110080 nonsense probably null
IGL02197:Ptprg APN 14 12220613 missense probably damaging 0.98
IGL02341:Ptprg APN 14 12154360 missense probably benign 0.00
IGL02732:Ptprg APN 14 12225617 critical splice donor site probably null
IGL03011:Ptprg APN 14 12219029 missense probably damaging 1.00
IGL03261:Ptprg APN 14 12225552 missense probably damaging 0.99
R0038:Ptprg UTSW 14 12213710 missense probably damaging 1.00
R0383:Ptprg UTSW 14 12219024 missense possibly damaging 0.93
R0433:Ptprg UTSW 14 12220620 missense probably damaging 1.00
R0488:Ptprg UTSW 14 12220653 missense probably damaging 1.00
R0503:Ptprg UTSW 14 12237138 missense possibly damaging 0.89
R0520:Ptprg UTSW 14 12199783 missense possibly damaging 0.92
R0570:Ptprg UTSW 14 12215896 missense probably damaging 1.00
R0606:Ptprg UTSW 14 12154131 missense probably benign
R1086:Ptprg UTSW 14 11952706 splice site probably benign
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1468:Ptprg UTSW 14 12190767 missense probably benign 0.02
R1519:Ptprg UTSW 14 12220596 missense probably damaging 1.00
R1662:Ptprg UTSW 14 12207357 missense probably damaging 1.00
R1714:Ptprg UTSW 14 12213697 missense probably damaging 1.00
R1716:Ptprg UTSW 14 12154360 missense probably benign 0.00
R1797:Ptprg UTSW 14 12199743 missense probably damaging 1.00
R1803:Ptprg UTSW 14 12091410 splice site probably null
R2104:Ptprg UTSW 14 11952897 critical splice donor site probably null
R2125:Ptprg UTSW 14 12179283 missense possibly damaging 0.74
R2126:Ptprg UTSW 14 12154355 missense probably benign
R2133:Ptprg UTSW 14 12211637 missense probably damaging 1.00
R2471:Ptprg UTSW 14 12210327 missense probably damaging 1.00
R2571:Ptprg UTSW 14 12122135 missense probably benign
R3821:Ptprg UTSW 14 12226375 missense probably benign 0.00
R4196:Ptprg UTSW 14 12122002 missense possibly damaging 0.51
R4392:Ptprg UTSW 14 12142467 missense possibly damaging 0.80
R4665:Ptprg UTSW 14 12215288 missense possibly damaging 0.90
R4730:Ptprg UTSW 14 12213713 missense probably damaging 1.00
R4737:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R4764:Ptprg UTSW 14 12122068 missense probably benign 0.01
R4801:Ptprg UTSW 14 11554233 utr 5 prime probably benign
R4825:Ptprg UTSW 14 12220654 missense probably damaging 1.00
R4960:Ptprg UTSW 14 12237837 missense probably benign 0.07
R4980:Ptprg UTSW 14 12154421 missense probably benign 0.16
R5004:Ptprg UTSW 14 12220667 missense probably damaging 1.00
R5058:Ptprg UTSW 14 12037387 missense possibly damaging 0.82
R5182:Ptprg UTSW 14 12154174 missense probably benign
R5258:Ptprg UTSW 14 12142431 missense probably benign 0.11
R5338:Ptprg UTSW 14 12154111 missense probably benign
R5353:Ptprg UTSW 14 11554235 utr 5 prime probably benign
R5373:Ptprg UTSW 14 12213665 missense probably benign 0.00
R5387:Ptprg UTSW 14 12153873 missense probably damaging 1.00
R5616:Ptprg UTSW 14 12122120 missense probably benign
R5623:Ptprg UTSW 14 12153857 missense probably damaging 1.00
R5976:Ptprg UTSW 14 12211625 missense probably damaging 0.96
R6027:Ptprg UTSW 14 12220613 missense possibly damaging 0.87
R6091:Ptprg UTSW 14 12215979 missense probably damaging 1.00
R6184:Ptprg UTSW 14 12153943 missense probably benign 0.00
R6234:Ptprg UTSW 14 12213747 missense probably damaging 1.00
R6318:Ptprg UTSW 14 12237118 missense probably damaging 1.00
R6324:Ptprg UTSW 14 12226314 missense probably damaging 1.00
R6334:Ptprg UTSW 14 12166832 missense probably damaging 1.00
R6646:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6647:Ptprg UTSW 14 11962714 missense probably damaging 1.00
R6992:Ptprg UTSW 14 11962602 missense probably damaging 1.00
R7088:Ptprg UTSW 14 12207365 missense probably damaging 1.00
R7250:Ptprg UTSW 14 12166767 missense probably benign 0.18
R7342:Ptprg UTSW 14 12237151 missense possibly damaging 0.90
R7358:Ptprg UTSW 14 12154198 missense possibly damaging 0.59
R7410:Ptprg UTSW 14 11962657 missense probably damaging 1.00
R7448:Ptprg UTSW 14 12142461 missense probably benign 0.12
R7514:Ptprg UTSW 14 12179342 missense possibly damaging 0.86
R7523:Ptprg UTSW 14 12237130 missense probably damaging 0.97
R7672:Ptprg UTSW 14 12211668 missense probably benign 0.04
R7709:Ptprg UTSW 14 12226452 missense probably damaging 1.00
R7720:Ptprg UTSW 14 12211703 missense probably benign 0.31
R8860:Ptprg UTSW 14 12213685 missense probably damaging 1.00
R8992:Ptprg UTSW 14 12154170 missense probably benign 0.00
R9054:Ptprg UTSW 14 12213638 missense possibly damaging 0.58
R9587:Ptprg UTSW 14 12215992 missense probably damaging 1.00
R9621:Ptprg UTSW 14 12237809 missense probably benign
R9625:Ptprg UTSW 14 12152027 missense probably damaging 1.00
R9773:Ptprg UTSW 14 12199806 missense probably damaging 0.97
X0020:Ptprg UTSW 14 12110070 frame shift probably null
X0027:Ptprg UTSW 14 12110070 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCGTGCTTTCTAGGGAACAG -3'
(R):5'- TCTAGGAATACTTGGAGCCCAGC -3'

Sequencing Primer
(F):5'- CTTTCTAGGGAACAGGCATTTG -3'
(R):5'- TACTTGGAGCCCAGCAAAGTTTG -3'
Posted On 2016-04-27