Mutagenetix > Incidental Mutation

Incidental Mutation 'R4972:Prph2'

384553

Institutional Source

Beutler Lab

Gene Symbol

Prph2

Ensembl Gene

ENSMUSG00000023978

Gene Name

peripherin 2

Synonyms

Nmf193, Rd2, rds, Tspan22

MMRRC Submission

042567-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4972 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

46910459-46924933 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 46910807 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 37 (L37F)

Ref Sequence

ENSEMBL: ENSMUSP00000024773 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024773]

AlphaFold

P15499

Predicted Effect

possibly damaging
Transcript: ENSMUST00000024773
AA Change: L37F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: L37F

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	16	288	2.2e-28	PFAM
low complexity region	333	346	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162469

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.0%
20x: 91.2%

Validation Efficiency

93% (82/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3425401B19Rik	A	T	14: 32,661,404	I868N	possibly damaging	Het
A730013G03Rik	C	G	1: 192,833,773		noncoding transcript	Het
Actl11	A	G	9: 107,929,956	T493A	probably benign	Het
Actn1	T	C	12: 80,173,039	D686G	probably benign	Het
Adamts1	G	A	16: 85,795,945	T525I	probably damaging	Het
Adcy10	T	A	1: 165,556,862	L1064H	probably damaging	Het
AI661453	A	T	17: 47,466,399		probably benign	Het
Apba1	T	A	19: 23,912,536	S433T	probably benign	Het
Arid4b	T	A	13: 14,160,272	N355K	probably benign	Het
Bsn	A	T	9: 108,115,178	M1125K	probably damaging	Het
C2cd5	A	T	6: 143,013,224	M1003K	probably damaging	Het
Ccdc18	A	G	5: 108,192,003	M805V	probably benign	Het
Cep89	T	G	7: 35,432,552	L637R	probably damaging	Het
Col24a1	A	T	3: 145,509,684	I1444F	probably benign	Het
Commd4	A	T	9: 57,155,448	S175T	probably benign	Het
Coq7	A	G	7: 118,510,117	V236A	unknown	Het
Dctn2	C	T	10: 127,276,703	R176C	probably damaging	Het
Ddx31	T	C	2: 28,860,770	F389L	probably damaging	Het
Dgkz	C	T	2: 91,945,702	R72H	probably benign	Het
Dpysl4	A	G	7: 139,090,290	D24G	probably damaging	Het
Dydc1	A	G	14: 41,082,338	T106A	probably benign	Het
F13b	A	G	1: 139,510,923	Y355C	probably damaging	Het
Fcrl5	A	G	3: 87,454,650	M407V	probably benign	Het
Fzd5	C	A	1: 64,736,012	V197L	probably benign	Het
Galnt16	G	T	12: 80,572,329	E70*	probably null	Het
Gm8979	T	C	7: 106,083,314		noncoding transcript	Het
Gpr171	A	T	3: 59,097,965	F130I	probably damaging	Het
Grin3a	T	C	4: 49,770,484	N763D	probably damaging	Het
Gsta2	A	T	9: 78,337,679	M51K	probably damaging	Het
Hacd3	A	T	9: 64,990,436	I298N	probably damaging	Het
Il18r1	C	T	1: 40,491,064	P317L	probably benign	Het
Iscu	T	A	5: 113,776,976		probably benign	Het
Kif6	A	G	17: 49,707,619	D250G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lcn6	T	A	2: 25,680,067	C82S	probably damaging	Het
Mob4	C	G	1: 55,151,002	L135V	possibly damaging	Het
Mpzl3	T	A	9: 45,062,256		probably benign	Het
Mvp	T	C	7: 126,989,798	D599G	probably damaging	Het
Myo1a	T	C	10: 127,716,309	Y766H	probably benign	Het
Myo5b	A	G	18: 74,627,193	H260R	probably damaging	Het
Nbea	C	T	3: 56,085,246	R313H	probably damaging	Het
Necab1	T	A	4: 14,978,216	D211V	probably damaging	Het
Nefl	G	T	14: 68,086,763		probably benign	Het
Nfx1	T	A	4: 40,976,375	D16E	probably benign	Het
Nlrp9a	G	T	7: 26,570,539	C797F	probably damaging	Het
Olfr1280	T	A	2: 111,315,818	V113E	probably damaging	Het
Olfr467	A	G	7: 107,814,746	Q56R	probably benign	Het
Pde6b	A	G	5: 108,425,264	D500G	probably benign	Het
Pgs1	T	C	11: 118,005,893		probably null	Het
Polr3b	T	A	10: 84,638,124	I189N	probably damaging	Het
Ppwd1	A	T	13: 104,220,108	S300T	probably benign	Het
Prl2c2	A	C	13: 13,002,170	N55K	possibly damaging	Het
Prpf19	C	T	19: 10,899,345		probably benign	Het
Ptprg	G	T	14: 12,226,427	R565L	possibly damaging	Het
Rab8a	C	T	8: 72,171,275	T74M	probably damaging	Het
Rexo1	A	T	10: 80,549,693	F510L	probably damaging	Het
Rexo2	G	T	9: 48,479,389	T51K	probably damaging	Het
Sh3d21	T	C	4: 126,152,416	K147R	possibly damaging	Het
Skint6	A	G	4: 112,835,068	I1062T	probably benign	Het
Spag16	C	T	1: 70,724,928	R636W	probably damaging	Het
Spata16	T	C	3: 26,840,723	I307T	possibly damaging	Het
Speer4f2	T	G	5: 17,374,425	I74S	probably benign	Het
Svep1	T	A	4: 58,087,778	Y1767F	possibly damaging	Het
Swt1	T	C	1: 151,423,542	S7G	probably benign	Het
Tex9	A	G	9: 72,478,338		probably null	Het
Thsd7b	C	A	1: 130,188,572	P1354H	probably damaging	Het
Ticrr	A	G	7: 79,669,668	D467G	probably damaging	Het
Tmco5b	A	C	2: 113,296,993	D303A	probably damaging	Het
Trpm7	A	G	2: 126,824,058	V876A	probably damaging	Het
Ttc21a	G	A	9: 119,944,961	E245K	probably benign	Het
Vezt	C	T	10: 94,000,350		probably null	Het
Zscan20	G	A	4: 128,592,359	P183S	probably benign	Het

Other mutations in Prph2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Prph2	APN	17	46919778	missense	probably damaging	0.97
IGL01087:Prph2	APN	17	46911159	missense	probably damaging	0.97
PIT4480001:Prph2	UTSW	17	46911113	frame shift	probably null
R0025:Prph2	UTSW	17	46919771	missense	probably benign	0.17
R2235:Prph2	UTSW	17	46911166	missense	probably damaging	1.00
R3120:Prph2	UTSW	17	46923372	missense	possibly damaging	0.49
R3954:Prph2	UTSW	17	46910718	missense	probably benign	0.39
R4864:Prph2	UTSW	17	46910922	missense	probably benign	0.03
R5645:Prph2	UTSW	17	46910667	start gained	probably benign
R5687:Prph2	UTSW	17	46923465	missense	probably damaging	0.99
R6494:Prph2	UTSW	17	46911081	missense	probably benign	0.03
R6658:Prph2	UTSW	17	46919864	missense	probably benign	0.05
R7775:Prph2	UTSW	17	46910806	missense	possibly damaging	0.82
R7778:Prph2	UTSW	17	46910806	missense	possibly damaging	0.82
R7824:Prph2	UTSW	17	46910806	missense	possibly damaging	0.82
R8098:Prph2	UTSW	17	46919966	missense	probably benign	0.09
R9221:Prph2	UTSW	17	46919892	missense	probably damaging	1.00
R9703:Prph2	UTSW	17	46923521	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTAACGGGGATCCCAAGCTAGG -3'
(R):5'- TTCCACTTGGCGTACTTGGC -3'

Sequencing Primer
(F):5'- AACTCCCTGCAGCTTGGG -3'
(R):5'- TACTTGGCCGGGTCCAG -3'

Posted On

2016-04-27