Incidental Mutation 'R4972:Prph2'
ID384553
Institutional Source Beutler Lab
Gene Symbol Prph2
Ensembl Gene ENSMUSG00000023978
Gene Nameperipherin 2
SynonymsNmf193, Rd2, rds, Tspan22
MMRRC Submission 042567-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4972 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location46910459-46924933 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 46910807 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 37 (L37F)
Ref Sequence ENSEMBL: ENSMUSP00000024773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024773]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024773
AA Change: L37F

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024773
Gene: ENSMUSG00000023978
AA Change: L37F

DomainStartEndE-ValueType
Pfam:Tetraspannin 16 288 2.2e-28 PFAM
low complexity region 333 346 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162469
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.2%
Validation Efficiency 93% (82/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation display slow retinal degeneration with thinning and loss of the outer nuclear layer, loss of photoreceptor outer segments, and increased numbers of Muller cells. Heterozygous mice also display retinal degeneration and Muller cell gliosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A T 14: 32,661,404 I868N possibly damaging Het
A730013G03Rik C G 1: 192,833,773 noncoding transcript Het
Actl11 A G 9: 107,929,956 T493A probably benign Het
Actn1 T C 12: 80,173,039 D686G probably benign Het
Adamts1 G A 16: 85,795,945 T525I probably damaging Het
Adcy10 T A 1: 165,556,862 L1064H probably damaging Het
AI661453 A T 17: 47,466,399 probably benign Het
Apba1 T A 19: 23,912,536 S433T probably benign Het
Arid4b T A 13: 14,160,272 N355K probably benign Het
Bsn A T 9: 108,115,178 M1125K probably damaging Het
C2cd5 A T 6: 143,013,224 M1003K probably damaging Het
Ccdc18 A G 5: 108,192,003 M805V probably benign Het
Cep89 T G 7: 35,432,552 L637R probably damaging Het
Col24a1 A T 3: 145,509,684 I1444F probably benign Het
Commd4 A T 9: 57,155,448 S175T probably benign Het
Coq7 A G 7: 118,510,117 V236A unknown Het
Dctn2 C T 10: 127,276,703 R176C probably damaging Het
Ddx31 T C 2: 28,860,770 F389L probably damaging Het
Dgkz C T 2: 91,945,702 R72H probably benign Het
Dpysl4 A G 7: 139,090,290 D24G probably damaging Het
Dydc1 A G 14: 41,082,338 T106A probably benign Het
F13b A G 1: 139,510,923 Y355C probably damaging Het
Fcrl5 A G 3: 87,454,650 M407V probably benign Het
Fzd5 C A 1: 64,736,012 V197L probably benign Het
Galnt16 G T 12: 80,572,329 E70* probably null Het
Gm8979 T C 7: 106,083,314 noncoding transcript Het
Gpr171 A T 3: 59,097,965 F130I probably damaging Het
Grin3a T C 4: 49,770,484 N763D probably damaging Het
Gsta2 A T 9: 78,337,679 M51K probably damaging Het
Hacd3 A T 9: 64,990,436 I298N probably damaging Het
Il18r1 C T 1: 40,491,064 P317L probably benign Het
Iscu T A 5: 113,776,976 probably benign Het
Kif6 A G 17: 49,707,619 D250G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lcn6 T A 2: 25,680,067 C82S probably damaging Het
Mob4 C G 1: 55,151,002 L135V possibly damaging Het
Mpzl3 T A 9: 45,062,256 probably benign Het
Mvp T C 7: 126,989,798 D599G probably damaging Het
Myo1a T C 10: 127,716,309 Y766H probably benign Het
Myo5b A G 18: 74,627,193 H260R probably damaging Het
Nbea C T 3: 56,085,246 R313H probably damaging Het
Necab1 T A 4: 14,978,216 D211V probably damaging Het
Nefl G T 14: 68,086,763 probably benign Het
Nfx1 T A 4: 40,976,375 D16E probably benign Het
Nlrp9a G T 7: 26,570,539 C797F probably damaging Het
Olfr1280 T A 2: 111,315,818 V113E probably damaging Het
Olfr467 A G 7: 107,814,746 Q56R probably benign Het
Pde6b A G 5: 108,425,264 D500G probably benign Het
Pgs1 T C 11: 118,005,893 probably null Het
Polr3b T A 10: 84,638,124 I189N probably damaging Het
Ppwd1 A T 13: 104,220,108 S300T probably benign Het
Prl2c2 A C 13: 13,002,170 N55K possibly damaging Het
Prpf19 C T 19: 10,899,345 probably benign Het
Ptprg G T 14: 12,226,427 R565L possibly damaging Het
Rab8a C T 8: 72,171,275 T74M probably damaging Het
Rexo1 A T 10: 80,549,693 F510L probably damaging Het
Rexo2 G T 9: 48,479,389 T51K probably damaging Het
Sh3d21 T C 4: 126,152,416 K147R possibly damaging Het
Skint6 A G 4: 112,835,068 I1062T probably benign Het
Spag16 C T 1: 70,724,928 R636W probably damaging Het
Spata16 T C 3: 26,840,723 I307T possibly damaging Het
Speer4f2 T G 5: 17,374,425 I74S probably benign Het
Svep1 T A 4: 58,087,778 Y1767F possibly damaging Het
Swt1 T C 1: 151,423,542 S7G probably benign Het
Tex9 A G 9: 72,478,338 probably null Het
Thsd7b C A 1: 130,188,572 P1354H probably damaging Het
Ticrr A G 7: 79,669,668 D467G probably damaging Het
Tmco5b A C 2: 113,296,993 D303A probably damaging Het
Trpm7 A G 2: 126,824,058 V876A probably damaging Het
Ttc21a G A 9: 119,944,961 E245K probably benign Het
Vezt C T 10: 94,000,350 probably null Het
Zscan20 G A 4: 128,592,359 P183S probably benign Het
Other mutations in Prph2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Prph2 APN 17 46919778 missense probably damaging 0.97
IGL01087:Prph2 APN 17 46911159 missense probably damaging 0.97
PIT4480001:Prph2 UTSW 17 46911113 frame shift probably null
R0025:Prph2 UTSW 17 46919771 missense probably benign 0.17
R2235:Prph2 UTSW 17 46911166 missense probably damaging 1.00
R3120:Prph2 UTSW 17 46923372 missense possibly damaging 0.49
R3954:Prph2 UTSW 17 46910718 missense probably benign 0.39
R4864:Prph2 UTSW 17 46910922 missense probably benign 0.03
R5645:Prph2 UTSW 17 46910667 start gained probably benign
R5687:Prph2 UTSW 17 46923465 missense probably damaging 0.99
R6494:Prph2 UTSW 17 46911081 missense probably benign 0.03
R6658:Prph2 UTSW 17 46919864 missense probably benign 0.05
R7775:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7778:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
R7824:Prph2 UTSW 17 46910806 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TTAACGGGGATCCCAAGCTAGG -3'
(R):5'- TTCCACTTGGCGTACTTGGC -3'

Sequencing Primer
(F):5'- AACTCCCTGCAGCTTGGG -3'
(R):5'- TACTTGGCCGGGTCCAG -3'
Posted On2016-04-27